GenePrediction:GLEAN_5595 Details

Name: GLEAN_5595
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2157689..2155407 (- strand)
Length: 2283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2157689..2157301 (- strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_173:2157238..2156786 (- strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_173:2156729..2156607 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_173:2156553..2156448 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_173:2156379..2156309 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:2156237..2156176 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_173:2156119..2155407 (- strand)
Length: 713
>GLEAN_5595 class=GenePrediction position=GCSC_173:2157689..2155407 (- strand)
ATGAAGGCTGAGGACGTATCTTCTCTTCCGGAGAAGCTTTCCGGCGATTTTCGGACCATTGAGCCCTACCTGGTAGCGTT
GGACAAGCATCTCACACTTCGTACATACATCTCGGGTTATACCCTCAGCGATGTCGACGCAAAGATTTGGGTAGCTCTGG
CCGACAACCGTGTCTCCATCTCCTTCATACGCCGTGGGACTCTTTCCAACCTGAAGCGCTGGTTTGTCTTTGTCGAGGAA
TGCCACCCTGAGATCCAGGCTGGCATAAAGGCGGCCAAAGCAGCCCAGCACGCCAAGGTGGCCGCTGCCAGCAAAGCTGG
TGGTAGCTACAACCTTGCGTTGAAGGATGCTGACAAAGGTGTCGTCACACGCTTTCTCCCCGAACCATCGTAAGCAACAA
GACCGCGTTACTTTTAGGTACAAAACATAATCTTACCGTGTTGCCTACAAGTGGCTACCTTCACATCGGGCATGCCAAAG
CTGCCCTCCTGAGCGACTACTTTGCCCGTCAATACAACGGAACTCTTCGGCTGCGCCTCGATGATACCAACCCTTCAAAA
GAAAAGGGGGAATACCAGGATTCCATTTGCGAGGACCTCGAATTGATGGGAATCAAGGCCGACAAGCTGTCATATACATC
GGACTACTTTGACTACCTTTATGATATGGCTTTGAGAATCATCAAAGAAGGTGGTGCTTATGCAGACGATACAGACCAAG
AGACTATGCGAGACGAGCGGTTCAAGGGAATCGCATCGAAGAGACGGGAGCGAAGTGTGGAGGAGACATTGCGCATATTT
GAGGAGATGAAGAACGCGACCCCTGAAGGCGTTAAAAACTGCATCAGGGCAAAGATCTCATATGATGACAACAACAAAAC
CATGCGAGACCCAGTCATCTACAGGTCCGATATATAAATACCACCATGGCCCGCAGTTGAATTTGCTGACGACTTGATAG
AGTGAACATTGAAACAGCTCATCATCGAACCGGCACGACATGGAAAATCTACCCGACATACGACTTCGCCTGTCCTGTTA
CCGACAGCCTTGAGGGAATCACCCATGCCATGCGCTCCACTGAGTAATAATTTACCAATGCCGTGTTTGTTTGCTGTGCC
GACTGACATGACATAGATACACCGATCGCAACGCACAATATCAGTGGTTCTTGACAACCCTGAACCTGCGCCAAGTACAC
ATGTTTGATTTTGCCCGCATGAATTTCATCAGGACATTTCTTGTATGTCTATTTTTTTACACAATATTGCAGGGATCATG
ATCATCTTACTAGAAGCTAATCGTACGCAGTCCAAGCGCAAGCTGGCGAAGCTGGTTGATACCGGCCGTGTCTGGGGCTG
GGACGATCCTAGGATGCCGACGTAAGTTGCATATTTCGGACTAAATATTTTCAAACTGGAGTCAAGAATATGCTAAGAGA
ATCTCGCTACAGGATTCGTGGCGTTCGCAGGCGAGGCATGACCATCCCGGCGTTACGCGATTTCATCCTCAAACGTGAGT
TCAGTGTGGCCATCACGTTATACTGGTACATCAGACTGACGCCTGTAAAGAGGGTCCGAGCCGCAGCGTGACCACGATGG
AATGGGGCGCATTTTGGGCGACGAACAAGAAGGAAATTGATCCCATCGCACCACGGCATACTATTGTCGCGGCAAAAGAT
GCGGTCAAAGTTCGCCTTACTGGATCTGACGCCCCTGCTGAGTCCTTCACGGCCGAAAAGCCTTTACACCCAAAAAACAA
GGATGTCGGAACGAAGGCGGTGGTGTTTTCTTCGGAGATCATCCTAGACCAGACGGATGTGAAGCTAATGAAGGTCGGCG
AGGAAGTCACGTTGATGGCTTGGGGTAATGCGTTTGTTCGCTCGATTGAAGGAGGCGATGGCGACAGCCCCATCACAAGC
GCCACGTTCGAGCTAAACCTCTCCGGGGATGTGAAGAAGACAGACAAGAAGGTGACGTGGCTTTCTTCAAAGGGCCAGAA
TTTCGTCAGCGGCGAAGCATGGGACTTTGACTACCTTCTCACCAAGAATACCCTGGAAGAGAATGACAATTTGGAGGACT
GTCTGACTCCTGTTACTGCGACAGAGGAGGCCGTCCTCGGGGGAGAAAACATGTCAGAGCTTAAGAAAGACGATATTATC
CAGCTCGAGCGTAGAGGGTTTTACCGCGTCGATAAAGGGCTCAATGACTGGAAAGAGGGCGAGGCCGGGTTGAAGGGTCC
GAGAATTGTCTTGTTCGCCATCCCCAGCGGCAAGTCTAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62