GenePrediction:GLEAN_5596 Details

Name: GLEAN_5596
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2154597..2151429 (- strand)
Length: 3169
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2154597..2154295 (- strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_173:2154221..2152791 (- strand)
Length: 1431
Type: CDS
Source: GLEAN
Position: GCSC_173:2152340..2151429 (- strand)
Length: 912
>GLEAN_5596 class=GenePrediction position=GCSC_173:2154597..2151429 (- strand)
ATGGCGGACCAGAAGCAAGAGTCGCCTGTGAAATTGCCGAGCTTTGGTCGGCCTCGGCGTTATGGCCTTAACAAGTGTTT
TCCCCAAGTGGACCTTTTTGAATATGGGCGTGGAATGCTAAGCAAGGGCGTTACGCTGCGTGAGCGACGTATGCTTGACT
TCATAGGCACCATCACTGACAAGCCCGATTGGCACCGCAAAGTGTTTGACGAGGCCATTGTGGAAAAATGGCGAAATGAA
GCCAGGGATATGCCTCGGGTGGCTGATAACGACGTTTACATGTCTGAAATCATGTTCGACAATGTAAGGCACCTTCCTCC
TTTCCAGCCCAGTTGCAATAGTGACAAAGTGAAACGAAACCTAATGTCTGCTGCAGTGTATTTCCGAAATTCGTGATAAA
GCTACTCGGTTCGATGTCACGGGGCTCGTAGGTACGCTTGATGCTGAGCTTGCGGTGGTGAAGTCAGACGTGGCTGTGTC
AGAACACCTGGCGGCGCAACTACGCCAGCTTGCCGAGGTTCTAGAGAATGCCCCGGACACCCAAAAAGACTGGCATCCTG
GTTCGGACAATCAAGTTCTCGACCTTCTTCACCCATCCTTATTCCCTGTTGTCTTCGGTAGAACACGCGCGCTGCGAACG
GGAAAGGTCGGCCTGGATGACGCTGCATCGTTTTCGGGAAAAGGAGAACTAACTTCCGACGTCGAAGAAGGGGAAAGGCT
CAGGTGCGGTGAAGACTCATATCAATGGCTTCCCTCAGATGTTGTGCTCAGCGACTCTGGAGCGTCCATCACAAGCTACA
TAAACAACCTCCGTTATGAGCATCACAGAGAGCTTTACAAAGTTTTGGAACAATTCGTTGTCGCAGCTGTACCTCTCTGG
GAAGAATGCCTCTCGTGGTGGAACGACCGCCGACGTTTTACAATCACGGATACCAGCGACGAGGATGACTTCTTTATCCC
TGAGGGTATCGAATACACCATTCCGGACCAATTCAAAAACAGTGACGGTACCATAAATGACGAGTACAGGTTCGAACCAG
AGTACGAAGACTGGGAGATTCGACATGGAGTACTCAAGTTTCGCGAGCCAGACTTGCCATACGAGCCATTTGAAAAGAAG
GTGGACCTTGGCAGCCGTTGTAACTTGAAGGAGAACTTTCCCAAAGGGTTGCAGATAATTTTTAAACTGGCCAATATTCA
TCTCACCCCCGACAAGCCGTCGTATGCAGGTGGCACTTGGCATGTCGAGGGAACGGCATCAGAATGCATCTGTGCAACAG
CCATCTACTATTATGACGAAGAAAACATCACCGAGAGTCGGCTATCTTTCCGCCAGGAAGTGGACGAGGAGAACATGAGT
TACATTCCGGCACAAGGCGCCTATCGAAGCCTTGAGAAATATTTTGGTGTGGTCGCGGATGGCAATACGGTCCAAGAACT
GGGTAGCGTGGTAACGCGAGAGGGGAGGCTGCTTGCTTTCCCGAATGTGCTGCAGCACAAGGTTGGCTCATTCAGGCTGA
AGGACCCAGAGAAGCCTGGACATCGCAAGATTTTAGCCATGTTTCTTATCGATCCCCACCGAAGAATTTTGTCTACCGCC
AATGTCCCACCACAACAAAAAGACTGGTGGGCAGATCACGTCAGGCAAACACCTGCGTTCCAGAAACTGCCTCCGGAGTT
GTTCAGTGAAATTATTAACTCGGTGGATACGTGCCCTATCAGTCTGGACGAGGCCAAGGAGATCCGTAAGGACTTGATGT
TTAGTCGGAGCGTCCTCCGTGAGGAGCAAGATGAGTTGCTGAACGAGGTACGTAAACCCCCCCACGACTCTTATTGGGTT
ACAATACCGACTATTTCAAAGACTACATATTCGTTTTGTGAGCATTAGCTTTAGTGCTTGTCACCGTTCTCACTCTCCAT
CTGTTGAAGAGTACCATGAAACATAAAAAAACAGTTCTCAGTAGTCGTTTCCTTGTTCTTTAAAGGAACGATTAAGGTAG
TTGTAAATATAAGCACAAATACGGTGTAAATAAGCAGCATAAAGCAAACAGTACGGAGTACTCCATATTCCGTATCTTAT
CTTACTTTCGTTTTAGCTATCTCACCGCTTTTAAAGTATCTTATAAGAATTCTGCCGCATTTTCCACTAAAAAAACATTC
TTCAGTTAGTAGACATCGGCAGAAAGCAATTAGAATACTAAAGACGACATCTTTAAGCAGCATACAAACACTCAGTATGG
AAAACACTGCGACAAAGAGGCGACGCGGGGAAGAGCCCTCAAGGCAAAAGAGTGACCGTTTCACGAAGAAGGCCAAGAAC
CTGCCAAATGCACAATACATCGACTCGGAAGCAGATGCCGGAAGCAATAGCCAAGATTTTCAAGCTGTCAGCCTGCTTGA
CTCTGACGATGACTTGGACAATGCAGAGGTCGACGACGGCATGTCCACAGATGAAGGCGAAGACTCGGAAGATTCTCTAG
ATTCCTTGGCCCATGTTCCATTGCGGACATCCTCTCGAAAGCGTCGCCAGTCTCCCAACAAGGGCATGAAGGATGCTCCG
TCTGACGACGACGACATGGGAGACATGTCCTCTATAGACGACAGCAGCGACGAGGGATCGAACCGGGCTGGCCCCAGATC
CAAGCGCAACGACCCTAGCACATTCTCGACCTCTTTGCAGAAAATTCTCGGGACAAAGCTGTCTACATCCCGCCGATCGG
ATCCAGTCCTTGCCCGCAGCGCTGCCGCACGAGAGGCCAGTCGGCGAATTGTTGATGCGGCGCTTGAGGAGAAGGCAAAA
AGGCAGCTGCGGCTAGAAAAGCGAGTGGCACTGGAGAAGGGCCGTGTGAAAGATGTATTGATTGCATCGAACGCGAGCGG
TGCTGAGTTTGGTGATGCGACAAATGGGGACTCCGAAACAACGGCAACAATATTGGAAACAGAGCGCAAGCTACGCAAGG
TGGCACAGAGAGGTGTTGTCAAACTCTTCAACGCGGTGCGCGCCGCGCAGGTCAAAGCTGCTGAGGCCGAGAGGACAGCC
AAGAAAGAGGGCGTCTTGGGTATAGACAAGAGGGACGCAAAGATTACGGAAATGAGCCGCAAAGGATTTTTGGATTTGAT
TGCATCCGGCGGTGGTGGCTTGAAAAAGGGGGGGCTAGAGGAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62