GenePrediction:GLEAN_5597 Details

Name: GLEAN_5597
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2149844..2148344 (- strand)
Length: 1501
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2149844..2149596 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_173:2149530..2149064 (- strand)
Length: 467
Type: CDS
Source: GLEAN
Position: GCSC_173:2148977..2148344 (- strand)
Length: 634
>GLEAN_5597 class=GenePrediction position=GCSC_173:2149844..2148344 (- strand)
ATGTTTGCAGATATCGACTACAAGGAATATCTGGCAGATCCGTCGCCATCTGCTATGCAGTCGGTTCGGGATGTTGTTGA
TGACCTCATCTGGCGGTACACGTCGGTCCTGATGGCACAACCCTTCGAAGTGGCCAGGACCATACTTCAAGTTCGCAGCC
ATGACGACGTTCTCGCTGTTGCGGTCCCTGACTTGGAGCTCGCAAAACAAGAGATAACACCTTCTTATGAAAGCGTTATG
CCAAACTCTGTTAGCATTGTCTCCAACCGTGCCGTGAAGGAGCGTTGTGCAGCTTTGCTAATGTTGTATGCTAGTTCGCC
GGCTATGATTCCGATTTAGACGAGCCCAACTATTTTGCACCGAACGTGCCGAATCCCTCGTCCACCTTGTATCCGGCTCA
AAGGCAAAGGAGTTCACCTTCATTGCCGCCGTCACAAGTTGCCAACCCAACGGTGCCGCTCCCCTCTTACAGACTCGAAC
TTCAAAAGGCGAATTCTATTGTCGAGGTCATATCGCAGTTGTGGCAGAAAGAGGCTGCTTGGGGTGTCTGGAAAGGGACC
AATGCATCCTTCCTCTACACTGTTGTGCAGTCCCTCCTTGAAAATTGGTCAAGGAGTCTACTCAGCGCTTTGTTTAACGT
CCCAGACCTAGGTCTGAAGGATGACGTCGACCGCTTGATCGATATTGCGTCTCCATACCCTTGGGCGTCTCTATTTGTTG
CAGCGGCAGCAGCTGTAACCACAGGCCTGGTTTTGTCGCCTCTGGACCTTGTCCGAACAAGGTAGGTAACGACTTCTTTG
CTATTTGCCAACGCATCGTACACGGGATTCTTGAGCATGGCGCTGTCGTACTAACAAGTGTGGAAAGGCTCATTTGCACA
CCAACATATCGCCAACCGCGACGAGCACTCTCTCTTCTCCGCAACTTGCCCTCCCTCGTGTGCTCGCCGGCACTGGCCAT
TCCCACTATTCTTCACTCTCTTATCCACCCCCTTCTGACACTTTCTACACCTCTCATACTGCGATCGCAGTTCTCGATTG
ATAGGGTTGCATATCCTTTTACGTTCTCAGTTGCAAAATTTTGCTCATCATCTTTTGCGCTGTTCGTCAAGCTGCCCCTG
GAGACCGTGCTGCGGCGAGGACAGGCTGCCATTTTGAACTCGCCAGAGTATGTGCAGGCCCTTGAACCGGCACCGACAAC
TGCTGGCAGCGAAATGGCGCAGTCGACGGGCATGGAAACTATTGTGCCACTAGGCAAGTACATGGGCATTTTCGGAACCA
TGTACCACATTGTTTCTGAGGAGGGCCGCGTGCCTGTCTTGGACCCGCTTCAAAAGATTAAGCCCCATTCGAGGAAAGCG
AAGACAAAAGTCGCCCAGGCTGTGTACCGACAGGGCCAAGGCATGGAGGGCTTATGGAGAGGCTGGAAAGTAAGCTGGTG
GGGATTGGTCGGGCTGTGGACAGCGGCTACAATCGGCCATGGTGGCGACGGCGAGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62