GenePrediction:GLEAN_5598 Details

Name: GLEAN_5598
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2145557..2141596 (- strand)
Length: 3962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2145557..2144525 (- strand)
Length: 1033
Type: CDS
Source: GLEAN
Position: GCSC_173:2144443..2143489 (- strand)
Length: 955
Type: CDS
Source: GLEAN
Position: GCSC_173:2142367..2141596 (- strand)
Length: 772
>GLEAN_5598 class=GenePrediction position=GCSC_173:2145557..2141596 (- strand)
ATGGCGTCAAATTCCTCTTTTAGCCAGAGCTCCAGCCAGGGCTCCGGCTCAGGCTCGAACTCGGCGGACGACCGCATTAA
TCTCATCATAGCTGCTATTGCACTAGTCATTTCCGTTTTAGCCATGTTTATCACGACTTTCCAGGCCCTGCAGCAATACT
TTTCCTCAGCCGCCGGCCAGTCCTCATGCAGCAAAAAGGTCATCGGCTTGTGGTCCGACTATACCAAGCTGCACTTCACG
GCGTTTCGCCTTGAGGTCAGGTTCCGAGCGCCAGTTCTTTTTGTAGCACCACCGAAAAATGACAAAGGGCCGCTCGGAAA
ATCTGGCATCTTGCAATTAGACGGTTCCAATGAAAGCTACACTGCGACTCATACAATGCAGCCTGTTGAATATGCCGAAT
GGAAACCGCAAGAGAAGGAAAGCATCCGTACTGCCGACAACGAGCAGGCGACGTGGATATCTCTCATGATGGCCATCCAG
AAGATGGAAAGCGACTCTCGCAAGTGGCAGCAAGATATTTACAAGAACTACAAAGTAAAATTCGAGCCCACTATGACTGT
GGCAATGCAGGAGAAGACCCGCTCGTGGGATACCATGCCGGACGGCCTCTTGAAGCCATACGCCACCAGCACAATTGCGC
ACTTTGTCGAGATGATGGCCATGTTGGGTGTCCACTGGAAGGAGTTTGATCGCAACAATGACAAATACCGTGCACAGGGC
AACGGTTTCAGTGTGTCCGGATCGCTGGTGCCCAATCTGGGCATTGGTTTCACTTTCCAGAAAGTGGGAACAGCTACGTA
CAAGGTGTCCCGCATCGTTCCGAATGACTCTGTCAAGGAGCTCTGCTTTGGTTTCTGCCCTACAATCTTCCGGGACCAAA
CAACATACGCTGATGAACCGGATAAGGGTGTGCTGCAGCTGGGCACAAGCGCCGAGGTAGCTGCAACTTTGAGCTCCTTC
GGCTGCAATACAAATACAGTCAACTATTTCCGCGTTGGGAACGATCAAACACGTTACTCGCATCTGTTTCCTCGTATGTT
ATTTTTCCTCTGTTCCTGGCTATATGGCGATGACGCTTCATGCTAACAATACCAAGTCCCCTTTGAAATGGTAGGCATGG
TGGGCCACGTTCTACAGATAAAGGACACGGCATTTACCATGCTACCCAATCCCACATTCCTCACGTGGGACAAGTCCTCG
TTTTCTTTACCCAAACTCCTCGCGTGTTTCCGGGACGCTCTGGACAAGATATCAACAGCCAAGGGCTCGTCTAAGCAATT
CATACTTGTCTTAGAAATGATTGAAGGCGTGCAGGAGGCTGAGAGGCGGGAGTCTGCTACTAGACGGAAGGCAAAATTAC
AGGCCACGAAGGACAAAAACAAAGCGGCCGGTCCCCCAGCTTTGGACGTGCAAAGATCAAATGGGGTAGATGGTCCATCT
CTAGCGGCCCATAGGACAGTTCCAGTCTGGGCCCAGCTGAAAAAAAGGAGCACTCTGCGGCCAGATCGTGCAACGACTCG
GAGACCAGAATCACCAGTGCCACAGGCGGAAAATGGCCCCTTGGATACGGCTTTGGCAAATTCAGACGATTTGGAGAACC
CTCCCCGGAAGTTCCGGAACCTTGCTAACTTCGCCAAAGCCGCTTTAATTTTCAGGCAAACAGCGGCTGGAAATGGAAGA
CCAGCGCCGAAGGCACAACCAGTAGAGAACGACCCCGACGACGCTACGTTTCCATCATATATCAGATCCTTGCACTCTGC
AATCGAGGTGTGCGACCAATTTTTGAAACGGCCCAAATTGTTTCCTGTGGTCTCACAGGTCTTCTGCTTGCATTTCCAGG
AGGTTCTCAAGTACCTGAACTCTCAAGAGAACGCCAGAGAAGGCGCATCCAGCACTCATGCTGCAGACGACAAAAAGCTA
CAAGGCGCCCGTACTGACACCGTGACCGGTCCGAGAGCTTCCCAACCTGCTGATTCCGTATTCTCGACCAGCAGCCACGA
TGGCTACATTCCTCTGGAAGACCTCAACTCGGCACCATCGGCTGACCGGCACCGCTTGCTTGCAAATGTGTATGTGAATT
ACATACGCAATCGCATTATAAAGATCAAAATGCCACCAACGGAGTACAACCCACGAGAGAGCCAAGATGATGCAGACATG
CGAGACAGACCTCCGACACCTGTCAGGCTTTCCAAATACCAGCCCACAAGTGATGACGTTGACGATATATGGTGTAGCCT
CATGTTCCGCATGCTCTGTTGGCTCATGCTCCATGATTTCGATAAGAAGGACATTCAGATTAGCAAAAGCGACGTATTTG
ACTCGCGGTTGCCGGTTTATATATTATAACATTAGCTAGTGAGCGTGGCTTTTTGGACAACACGAAGTCTGCAGTAGTAC
ATTTTGTCTTCGATCTCAGTCTGTTTTTTCAAAAACTCCTAGAACGCTATCTTATTTACGATCATCCGATTGTGCCTCAA
GCTTTAATATTCCTTGTCACAGTAACAATATAGAAATTAGCAGGGTTATGTTCAAAGATGAAGAAGCGTACGGAAATTCT
TTTGTTCCTTGGAGAAAGTACGTGTCTCACAGGCATGTTAATTGCACGGAATACTCCGTACTACTTGGTTATGTGGTCGT
GCAAGATTAGCCGCGACGACGAATATGGCCACCGGAACGACCCATTTAGCCTTCATTTCTACGCCGGTCTACACCCTATG
TGAGGAATGCGTTGCAGAACCTGTTTGGTATCTCTGATAGTACTCCGTAGTGTCGTAGTTTCAGTCCCGTCAAAAAATGT
GGCTAGTACAGGTCCAGGTCGCTTTAGTTCTAAAACCCTTTTAGGACGTCGGGCACTCCCGATCGTACTGCGTATGAACG
TTTTTGTCTGAACCGCACGTGACTTCAGGCACCGGCTGGGAGCGATGTCAGCCTTTTATGGCCAGCATCTTGGGTCTCTT
GTTATTACTGAAAAGCACCAATAGCTGCGAATCGGAGATTATGTAAATGACAACTGAACATATCTTACAAATTTAACGCC
GTTCATTTTCCCCAGCTGGAGACAAAGAACCAGCACTAGTCGTATCTCGGTGGCCGATAGCACAACTAAATGGTGGAATA
CTTATCCCTGATCAACTCATCCCACTTGACATCACCAGCCGAACCATTGTAACTAACGCCAATAGCATAGACGCAAACAA
GGACACAAAATACAACACCACGTCGCCCCGAGAACGCCCTTCATGCCTACATATTGTATAATTGGAACAAACCGTGGCAT
GGGGCTCGAGTTTGTGCGGCAGCTCTCCTTGTCCCCCGAAAATACCATACTTGCCACCACACGCCCGGGTGCCGATCTCA
GTGATGTCCGGGCCGTAGCCTCGGCCACCACTCGCTTCTTGGATTGTGATGTTTCCAGTGTCCCCTCAATCCACTTATTT
GCGAACAAGGCTGCCCGAGTTCTTGATGGCAAGCAGATCGATTTTCTGGTGAATAACGCAGGCATCAACAACACACCGTC
CAGCGAGACCAGTCTGTCGCTAGACCACACCAATTTTGCTCAGCAGATGAGCGCCAACGTTGTGGGTCCTGCAAAGGTAG
TCGAGTTTTTGCTGGACCATAAACTACTCGCCCCAGCCGTCCGCATACTCAACATGTCTTCTGGTTGGGCAAGTCTGGAC
TCGAGCAGCAAGCTAAATCAACGCGCTTGTACCGGTTACAGCATCTCGAAGGCTGCCCTCAACATGCTCACAGTCCACCA
GGGAGGGGATATTCGCAATCGCCTACCGGAAGCTGTCGTAATTGCCATGGATCCGGGCTGGGTGAAAACAAGGATGGGTG
GCGATGGTGCCCCGTTGGAGGCGTCGTTTTCTGTTTCAGGCATGCTGAAAACCTTACAGTCGCTCAAGGACGAGGACAAC
TGTCTTTTTTTTGCATACGATGGAAAAAGGCGCCCGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62