GenePrediction:GLEAN_5599 Details

Name: GLEAN_5599
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2135922..2134945 (- strand)
Length: 978
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2135922..2134945 (- strand)
Length: 978
>GLEAN_5599 class=GenePrediction position=GCSC_173:2135922..2134945 (- strand)
ATGTCCTTGTTGCAGAAGAAGTACCTGATCACGGGTGCCGCTGGCATGGTTGGGTCCAACCTTGCAGCCCGCCTGCTACA
AGACCCTGAGAACATTGTCACCCTTACCGACATCATCGAGCCACCCATCCCAGTAAGGGCACGATATCCCGAAAACGCAC
GGGCTTTGGCGGCCGACCTTAGCGACGGCGATGCGTTGGTTAGAGTCGTGGCGATGTCCGTACCGCTGACAGCCGTCTTC
GTTTTCCATGGCATCATGTCAGGCGCCTCAGAGGCCAATCCATCACTGGCATATCGGGTAAACTTCGACGCCACGCGGGC
GCTGCTCCTGCACCTTGTCGATGTCCAGCGCGGCGTACGCATCATCTTTGCTTCCTCGAATGCCGTTTATGGCCCGCCAC
TGCCTGCGATCGTGAGCGAGGCTACTATGCCTACACCGACAGGTGTTTACGGCACATGCAAGTTTATGGTTGAGCTGCTT
ATTAATGATATGCACCGCAGGGGCTGTATCGACGCCTTCTCAGTACGCTTTCCAACAATATCTGTGCGCCCAGGAAAGCC
GGCGCCCGCTGCCAGTGCGTTTCTCTCTAGCATCATTCGAGAACCTTTAAATGGTCAACTCTCTGCCTTGCCGCTACGAG
ACCGCAGCTTCAAAGCCACACTCTGCAGCCCCCATACGTGTATAGAGAATCTGATCCGCGTAGCATCGTGGAAGTCAGAT
GTCTTGCCCCGACATCAAAGAGCCATAAATTTTCCCGGTATCATCGCAAGTGTGCAGGATCTTCTGGACGCGCTCGCAAA
TGTGGCTGGGGAAGACAAGCTAGCTCTTGTTACCGACGAACCACACGAAGCATACGAGGCGCTGCTTCGAAGTTGGGCCT
GGAACCTGGATTACTCATTGCCACTGTCACTGGGACTGAAGAAGGATGAAAGCGCGGAGGGCCTAGTGCGGGAGTATGTC
GAGTCCATGGGAAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62