GenePrediction:GLEAN_559 Details

Name: GLEAN_559
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:610433..611590 (+ strand)
Length: 1158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:610433..610758 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_97:610782..610902 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_97:610967..611590 (+ strand)
Length: 624
>GLEAN_559 class=GenePrediction position=GCSC_97:610433..611590 (+ strand)
ATGGACGCTTTCGAGCGCCCGCCTCAGCGCGATTCGTGGTTTGCACCAATCTCGATCGACCTCGTCCTCAAGGTCCTCTA
TGTCACATTTTTCCACCCGTTCGTGGCATGGCTCATCCCATTGTGCTTCCGCGCCGAGCACATGGGCTGGGAAGCCACGC
CGATGCGCGTTTCCATCGTCTATGCCATTTTCATCACGACATGCTGGGTGCTGAGCGCTTTCAACAAGCGTGTTGCTTTT
GGCACCCCACGCTCTGTCGACCTTAGCGAGGAGGTCATCGTCATTACTGGAGGCGCAAGCGGGCTGGGCCTGCTGATTGC
AGAGGTGTACGGCATTGTCGTGGCGCGAGCGTGGCCGTGTTGGATATCAAGGAGATGTCCAACGGCGAGGCACGCGGCGT
GTCGTTCTACAAGTGCGACGTCACCGACAGGGAGCAGGTGGCTAAGTGTGCTGCGGAGATCGAGAAGGATGTAAGTCATG
TCCGGCGCTTCTGGAAGTGAGAGGACTTGATGCTGACTCTTGCGATTGGCACAGCTCGGATGCCCGACCGTTCTGATCAA
CAACGCGGCCGTCGTGAATGGCAAGAAGCTGCTCGACATGGACTTTGCCGACGTCGAGAAGAGCATCCTGACGAACCTCC
TGTCGCACTTTTACACGCTCAAGACGTTCATCCCCGGCATTGTGCGCGGCGGCCAGGGCGGCACGATCGTGACGATCTCG
AGCGTCATTGGCGAGGTCGGGGCGGCGTATCTGACCGACTACGCAGCTTCCAAGGCCGGACTTGTTGCGCTGCACCGGTC
GCTGACGGCCGAGCTCAAGGCTGACCACCCGGACATTCGCACGGTGCTGGTGACGCTGGGCCAGCTGAGCACGCCGCTCT
TCTACGGTGTCCAGACGCCCAACTCGTTCATGGCGCCGGTGGTGGAGCCGGTGGACGTGGCCAAGGAGATCATCGCTGCC
ATTGACAACGGCAAGGCCGAGTTCATCGGCATGCCGTTCTATGCCCGTTGGATCGACTGGTACAGCGTGATGCCGGTGGG
TCTGCAGCAGATCGTGCGGTGGATCGCGGGCGTGGACACGGCAATGAAGTCGTTTATCGGGCAGAAGGCCGGCAGCAGCA
GTGAGAAGAAGAGCGACATGCTCATCGAGACGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62