GenePrediction:GLEAN_5601 Details

Name: GLEAN_5601
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2124531..2121195 (- strand)
Length: 3337
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2124531..2124318 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_173:2124244..2124129 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_173:2123950..2123811 (- strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_173:2123621..2123573 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:2122995..2122742 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_173:2122674..2121897 (- strand)
Length: 778
Type: CDS
Source: GLEAN
Position: GCSC_173:2121834..2121435 (- strand)
Length: 400
Type: CDS
Source: GLEAN
Position: GCSC_173:2121349..2121195 (- strand)
Length: 155
>GLEAN_5601 class=GenePrediction position=GCSC_173:2124531..2121195 (- strand)
ATGAAGGCGCCTTTTTCCTTGCAACAACCAAAGGACCCGAGGCGGTCGATATGGCAGGTCAACGAGGATCCAGAAAAACT
CGACCGCATGTACGAGAAGCTGGTCGGTCGCGACCTGACGCGGACTCTACCGGACGAACTCAAGTGGCTGGCGGTGACGC
ATAAGAGCTTCGACAACGGCCGGCGTGGATTTAACACGCGGCTGGCTTTCTATGGTAAATAGCACTGTGCTTCGCCTGGC
CTTTTTTCTGTCGTCTAGGAGCCGCGGTTAACAGATGGGGAGTGAAGGGCGAATGATTGTGGCATTGGAGGCGACACGAG
CAATCATGGGATCGCCGGCAGAAGGCATCGAAGCACCCGACCCATACGGCAGACAGCCGTTTGAGAATGCTGCCCTTAGC
AACGTGGATAAGCTCAATGTCTTGCAGCCCCATCATTATGCCAGTCCAGACAAAGTAGCCCAGCTAGCCAAAGAAGTTGG
CTTGCCAGGGGTTGTTCGGTGGAAACCGAGATTGGTACCGCTCTACCCCTGTTCCTTCTCTACTACCCTCGACTTCAATC
GATATACTGACGTGCTACCAGCCGGAAAATCTCGAGAGCTCCGGTATCACAGTGGTCCTAACGTCCACCGTTTTCTCGAT
CATTGGCGCGGTATCGTTGCACCATGGCGCCGACGTCGCCAGCCGGGTAGTTGGTGAGAGGATCTTCAAACGCATAAGCG
TGTAAGTAGCTAGATGTCTATGGAAGATGAGCAATCAGCGGGCCTGCTGTTCTGTATAAAATGAGGAGATAGAGTGGCAG
AAACACACATGACGGAGGAAAATGAACTTGTACATTATGCATCGGCCGGCGTCATACGTTGCAACAAGACAAAATACAAA
AACAGGGCCGTGACTTCGCTCACAATGCAGCTTTCACATGGAACTCGTCGGCACCGGCAACATATTTTTCGTCCTCGAGG
TTATATGCTTTCGGACGCATACGATATTACCCACAACGAACAGGCACATACAGACATCTATCCATGGCGCTTGCTATAGT
CAAGCCCGTCACCATGTCTGACGACGATACAGGCTAAGAGGATCCTCGCTGCCCATTCGCAGAAAATCTCACAGGAAGAG
CGGCTGAAACGGCCTTTAAGCAGACGGACAAGGGCCACTGGGCAAGGACGTCGACGTAGTGGAAGTTGTGAGGCAGGAAG
GTCATGTGCCAAATGTATAATCGCAGCTCTGGCGGCCCAGAACGGCAGAAAACTGAGCGCTCTGTGGACAGAGTGGAAAT
CGCAAAGGCTGTGATCTCAACCTGCTCAGCTCTGCCGATCGTTCCGCTCTCAGCTGGCAAACTGACGCTTATCTCCGGCA
TCTCGACTCATGCAAGTCGCCTTTAGTCTTTGGTCCCCTTGCACGTCTTCTTTCCATTGTTAATCTTCAGTTTTCCATTT
GGTCATTATCCCGAAAGAATGAAGTCCCGAATTGCCCATCTTTTAGCTCTGGCCAGTTCTGGCTTTGCTGCCGCAATTGC
TGCTACCAATGGCCAGCATGTTCTCACCAGCGGACAGGTTCCGTTCAGATGCGAGCTCCCGCCAGTGGTAGCACCAAACG
GCGATGGCTTAGCATCTGCCGATGAGCTTTTCTCTGGGCCAGAGGCTCTGAAGCTTCAGGTCCAGAGGCATTCGGCCATC
GTCCGCGTTCCGTCCGTCAGCTACGACGACTTGGGAGAGGTGGACGAGGATCCGCGCTGGTTGGTGTTCCATGAGCTTCA
CCGCCTCCTCGAAGAGCTATTTCCAGCAGTGTGCGTCCAGAGTGTTGCAGCTCCCTTTCCTTATGCTCTTTTAAGTTCCC
TATTAATATATGTCTAGCCATGCAAAGATGTCACTGGTCAAAGTAAATCGGTTCGGGCTAGTCTACACACTGGAGGGCAG
TGACCCGTCGCTGAAACGGCTTATGTTGGCAGCCCACCAGGACGTCGTGCCTGTTGCTGATGCCTCCACGTGGACGTATC
CCCCCTTTTCCGGCCACTTTGACGGCAGGTGGCTCTGGGGTCGTGGCGCCTCTGACGACAAAAATAGCCTAACCGGTCTG
ATGTCTGTCATGGAGACGCTGCTGAGCAACGAGACCTGGGTGCCGCGCCGTGGAATTGTCCTTGCCTTTGGCTTCGACGA
GGAATGCTCTGGTAGACGAGGAGCCGGGATCATTGCCTCCTACCTGGAAGAGCGCTTTGGCCGCAACTCGATGGCCCTTA
TTCTCGATGAAGGCGGCATGGGCATTTCTGCTGGCGGCAACAATACCCTCTATGCACTCCCAGCCGTCATGGAGAAGGGT
CACGTCGACGTTATCTACGCGCTGCATGTTCAGGGCGGGCACTCGTCCATGCCGTTTCCACACACGGGAATCGGCATCAT
CGCAGAGATCGTCAGCACGCTGGAAGCGCATCCGTATAGTCCTAAGCTGATCTCCGGTTCGCCTGTCCACAACCACCTCA
TCTGTCGAGCACGGTACTCGCCTGCTGACGATCCGGAGCTTACGCATCTGATCGCTAAAGGCGACCTTGCCGCGATCGCC
AAGCGGCTGGCAACCAGCGATCTGGCGACAAACTTTCGTCTGCAGACGTCACAGTCTGTCGACCTGATTGCCGGGGTACT
TCTCCTGTTACCTGTGCGAACGTTCTGTCTCTGTCCTTGTCGTTAACAGGGTTGCAGGGTGTGAAAATCAACGCAATGCC
CGAGCTGATCACCCTTGGTGTCAACTATCGAGTGTCGCCTCATAATTCGATTGACGAGATCAAGAAGACTACGGTCAAGC
TGATCCAGCCAATCGCGAGCAAGTACGGCCTCAGTCTCAAGGCTTTTGAAGATACTGCCTCGAAACCGGCGGCAGGCTCG
TCCGACAGCATGCTAGACCCAGGCTATACTAAGACAGTTCATCCTCTGTATGAGGTTGATTACAGCGGAACCCTCATCCT
TACAACACAGCAAGCCACCCCCGTAGCGCCTGTTTCGCCCACAACTGGCCCTGTCTGGGATCTGTTTTCCGGCACTATAC
AGCACACATTTTCCTTTGAAAACGGCACAGTTGTTCCCGTGGGCGAGATCATGACCGGTAACACTGACACACGACACTAT
CTAGGTAGCCCCCCAACCATCATCTTTGTGCAAGCCATAAAAGCACTGCTAACGCCAGGAAGACCTCACGCCCAATATAT
ATCGCTGGGTTCCGGTACGGGATGGTTACAGAAAAAACATGCATACCATTGACGAGCGTGTCGACATGTATGCCCATCTA
GAAGTTGTCAAGTTTTACTACAACCTCATTCGCAATTTTGATGCATCTGTTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62