GenePrediction:GLEAN_560 Details

Name: GLEAN_560
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:612051..615587 (+ strand)
Length: 3537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:612051..613460 (+ strand)
Length: 1410
Type: CDS
Source: GLEAN
Position: GCSC_97:613525..614558 (+ strand)
Length: 1034
Type: CDS
Source: GLEAN
Position: GCSC_97:614783..614843 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_97:615342..615587 (+ strand)
Length: 246
>GLEAN_560 class=GenePrediction position=GCSC_97:612051..615587 (+ strand)
ATGGCGGTCAACGCGGCGGCCAGCAGGGCCGGGATCGCGGTGCACAACTCGCTCAAGCCCGGGACGCCGGTGCACTTTGA
GCCCAAGCAGGAGGACACGGTGACGTGGTACTCGTGCGGGCCAACAGTGTACGATCTCAGCCACATGGGTCATGCACGCA
ACTACGTGTCGACAGACGTGATCCGGCGGATTCTGCGGGACTACTTTGGCTACAAGGTGCAGTTCATCATGAACATCACG
GACGTGGACGACAAGATCATCATCAAGGCACGGCGCAAGCGGCTCTTGGACCTGGAGCGCGAGAAGACGTACACGGCCGA
GCAGCGGCACGCGCTAGGCTCGGCAGCCTTCCAGGCGTACGCAGCAGCGAACCTGCCGCTGCTGCTAACGGGCTACGCAG
GGCCGGTGGGGCTGAGCGAAGCCATCTATGCGGAGCGGCGGGACGCAGTGTACGGGGCGGTGCTGGCGGGCGGCACGCTC
ACGGGCGAGGGCCGGGCAGGCGATGCGGAGGCCAAGACGAAGATGCATGTGGCCAACATGGACTCGGCGGCACGCGGACT
CCAGAGCGGCACGGTATTCGAAGCGGCGGAGGAGGTGCTGCTGCCGTACCTAGACTCGCTGTACAAGGAGACGATCGACA
CGAGCGACCAGACCATGTTCACGGACCTGACGCAGGCGATGGAGAAGGCGTTCACGGACGACATGGACGCGCTTAACGTG
CTGCGGCCAGACGCGGTGACGCGGGTGACGGAGTACGTGCCGCAGATCGTGGCGTTCACAAAAGGCATCATCGACAAGGG
GTTTGCGTACGAGGCGAACGGATCGGTGTACTTTGACATTGAGGCGTTTGAGCGGGCGGGCAACACGTACGCGCGGCTGC
GACCGGAGAGCAAGAATGACAAGGCGCTGCAGGAGGAGGGCGAAGGGTCGCTGTCGAAGAGCCTAGCGGGCAAGCGGCGG
GCGGGCGACTTTGCACTGTGGAAGAGATCGAAGCCGGGAGAGCCGTTCTGGGCGAGTCCGTGGGGGGCTGGGCGGCCGGG
CTGGCACATTGAGTGCTCGGTGATGGCGTCGGACAAGCTGGGCGAGCAGATGGACATCCACTCGGGAGGTATCGACCTGG
CGTTCCCGCATCACGACAACGAGCTGGCGCAGAGCGAGGCCTTCTTCCACCGGCCAGGCGCGGGCGAGCACAGCTGGGTG
CGGTACTTCTTGCACATGGGTCATCTTTCGATTGCCGGGTCCAAGATGTCCAAGTCGCTCAAAAACTTCCAGACGATCCA
GGACGCGCTGGAGACGGGCTACACGGCCCGCAGCATGCGTATTGTGTTTATGCTGAGCCGGTGGAACGACGGGCTGGAGG
TGTCGCCGGACATGCGGAAGCAGGCGAGCAGCTGGGAGAACACGCTGGATGTGAGTGTTTTTGGCGGGTTTTGTTTGTGT
GATTACGTGTTTGTAATTCGTGCTAACCGACTAGAACTTCTTCACCAACATCAAGGCCCGACTGGCCGAGACCAGGACAG
GAACGATGACGAGCAAGGTGCAGAGCCTGTCCCTGCAGGACGGTCTGACGGCAGAGCTGGAGCAGGCACAACAGGACCTG
GACGCGGCGCTGCGCAACTCGTTTGACACGCCGGGAGCGATGCAGGTGATTCTGCGGGTAGTTCGCAGTGCCAACGTGGC
GATGAGCGAGGCAGGAGCAGACCTGGGACCGGTGGAGGCGGTGGCGCACTGGGTGACCAAGGTGGTGGGCATCTTCGGCC
TGGACGCGAACGCGCAGCCGCCATACGAGGGCCGTGTGGGCTGGGGGCCGGCGAATCCGACAAAGACGACGGCTGGACAG
GACGTGGACCCGAAGACGGCCGTGCAGCCCTACGCGACAACGTACGCCAAGGTGCGAGCCGAGGTGACCGGTCTAGTCGA
GGCGGCGGGGGGCTCGCTGGCCGAGGTGCAGGCACTGCTGCAAGCCCAAGAGCCAGAGGCGGAGTTTGCGGCGCTGGCCG
ACAGCCAAGAACAGAACGTGGAGTGGCTGGCGCTGCCGTATCTGCGGGCGATTTCGGGACTGCGCGACACGCTGCGACGG
GAAGCAGCAGCGACAGGCGCAGAGACGAAACAGCAGGTGCTTGCGCTCAGCGACCGGATCCGCGACTACGACATGGCCGA
GCTGGGCGTGCAGCTAGATGACCAGCCGGAGCGGCCGAGCCTGATCAAGATTGTGCCAGCAGCGCGGCTGGTAGCGGCAC
GCGAGGAGAAGGCGGCAGCAGCGGCCGAGAAAGCACGGCTCAAAGCGGAGGCACAGCGGGCACGCGACCAGGCCGAGGCC
GACAAGTGGCTCCGGGCCAAGGTGACGCCGCAGGCACTCTTCCGCAGCTCGGAGGCGTACGGGGCGTGGGATGCGGACGG
GCTGCCGACGAAGCTGGCAGACGGTAGCGATGTGCCGAAGACGCAGCAGAAGCGGCTGAAGAAGGAGTGGGATCGACAGA
AGAAGCTGCACGACTCATACGTGGAGAAGTTTGGGGGGGAGGGGGGGAGAGAAGAGATGTGAGAGGGGAAGAAAGAGGGG
AGGAGAGAGAGGAAGAGAGAGAGGAAGAGAGAGAGGGAAGAGAAGGCGAGAGGCGAGATGTGTGATGGTAAAGCCGGTGG
AGGAGGTGAGAAGCGAGATGAGAGGTGAGATGAGATGAGAGACGAATGAGAAGCCCAGACAAGTGCTAATTGGCAGACGT
ACTGTCGATCAGCATCCAAAAGAAAAGAAACAACAATGCACAGATAACAGCAGACCAGGATCCAACAGCAGGGGTACGTA
TGCAGCAGCCCTGCAAGCATCTGAGGAGCGGTTATCTGCTTGCGAGTATGAGTACACTGTAACACTCCAATCGGGACATA
GTAAGCCGGAAGTATCTTCCTACATAGTATGTATCTTACATGCATGTCGTGCCAAGACCTGGAGGTGGTGGAGTCCCCGA
CTTTCGTGATAAGGCGAAGAGGACGTGCAAGGGCGTGGGGAAGAATATCTCTCCGCGCAGGCGCCGTCGAAGGACTCGTG
GCAATCCTTGCAGGGCACAAAGTACGGAGTCCTCGCATAGAGGATAGCAGATGCATAGGAGGTATACGAGTACATTGTAC
GGAGAAGGCTCACATTGGTGCTTTCCCTTTTTGCCGTGTCTGCTCCTTCCCCTTTCCCGTTCGACCTCACCGTCTTTCGC
CTTTTCCCTTTTCCCTTTTCCCTTTTCGCTCTGTCCGCCGTCTCACTCTCAGCTCATGCATGTGATCACGCCTCGGCGGT
CACTCGAACAGCCGGTCCTGCACGACGGCAAGACAGGTAGCAGCTGCCAGCCGCAGCCTGCAGCTACGACCTTGCTCGTC
TCACCTCAGCATCTCAGCATCTCATCACCGTGCGGCTCTGACGGCCTGTCCGACAGCCGGCTGCGGATCTGCCCTCGTCC
ACGCAGCGCCTGTCTGGCCACTCGCAGCACTGCCGTGTACGTAATGAATACGGACTGCTGGCACATGCGATGTGGTAGCG
TCCTTGCGGCAGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62