GenePrediction:GLEAN_5619 Details

Name: GLEAN_5619
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2020740..2018491 (- strand)
Length: 2250
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2020740..2020488 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_173:2020396..2020061 (- strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_173:2019996..2019740 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_173:2019678..2019585 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_173:2019509..2019335 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_173:2018755..2018491 (- strand)
Length: 265
>GLEAN_5619 class=GenePrediction position=GCSC_173:2020740..2018491 (- strand)
ATGTCTCTGTTCCGCAAACCTTTCAGCCGCAGGGCAGAGGAAACCAGTGTTGGAGACGAAGGTGCCCGCGTGATCTCAGA
TGGCGGCCTTCAATATGTCATAGAGAAAGCCGACAATGGCTCTCTTCCCGCCTACCAGGAGGCCACAGGGGCTCCGGTCG
AGCACCACTCGCCTCTGGGCTACGGTGTTGGGCCCGTGACCATCATCTTTGTCAATATCAGCATGATGGTCGGGACAGGC
GTCTATTCTACGCGTGAGTGCCATCGCGGAGAGTTTGCATGAAAACAAGGCATCGAAGTATAGACAGAAGAGGAGACAGG
AAAACAGCTTTCTGACAGCTGCAGCTTCCACCATCTACAAGGGCGCTGGCTCTGTCGGTCTCAGCATGATATTCTGGGCA
TTGGGCTTCTTTATGTCGCTGGCGTCCATGAGCGTCTATCTCGAGTTTGCTTCGTACTTTCCCAACCGCTCTGGTTCCGA
GGTCGTCTATCTCGAGCAGGCATTCCCGCGCCCGCGCTGGCTGTTCCCCACTACATTTGCCTTCCAGTCCGTGGCCTTGT
CGTTCAGCAGCGGCAACTCCATCGTGTTGGCCCAGTATCTCTTCAAGACCAGCGGCCACACACCAACCAACTGGCAGCTC
AAAGGCGTCGCCGTTGCCGGCTACACGGTCGCGACACTATGTGAGTATTTCATCAGAATGACCATTACGACAAGGCAGGT
CACCGACTGACAAGTCGTGCTTAGTTGTCATCTTTCACACGCGAACCTCGTACATCATCTCCAATGTGATCGGTGCCGTG
AAGGTCCTCACGCTCGTTTTTATCGCTATCACAGGCCTCGTCGTCCTGGGCGGTCACACTCGTGTTAAGGACCCCCATGC
TAACTTCGTGGACTCGTTCACCGGGCACACCTCGGCGTACGGCGCCACCAACGCCATATACAAGATCATCTTCTCCTATG
CTGGATACAACAACGCTTTTAACATGATCAACGAAATCAAAGTACGTGTGTCAACCACAGAATCTCTTGCTGTATCGAAT
TCTGATCGTTTTCGTCTCTTAGAACCCCATCAAGCAGATCCGCCGCAATGGCTTCATCTCTCTTGTAGTCGTGGCCATAT
TGTATATATTTGCCAACTTAGCCTACTTTGCCGCAGGTGAGTCTCCCACAAAGACTGGTCTCGATCCGCCTAAGCATTGA
GCCTTGATTATTATTTACATTGCTCCTGTAGTGCCCAAGGCTGAGCTCGCCGCGGCCAAGCAGACAGCGGCCAGCCTCTT
CTTTTCCCATGTTTTCGGCGATAAGCACTCCGTGCGTGGGCTCAACATCCTCATCGCCCTTAGCTCGTTTGGAAACCTCA
TTGCTGTGCTACTTGGCACTTCGCGACTTCTCCGCGAGTGTGGCAGGTTTGGAAGCCCTCCCTTCAACGTTTTGTTGTCA
GTGTCTGACCCTCTTTAGACAAGGTATTCTGCCCTTTCCACGCTTCTGGACATCGACCCGTCCTTTTGGAACGCCCTTGG
GCCCTTATATCGTCAAATGGGGCTTAACTATGATCATGATCCTTGCCCCTCCGGCTGGTGATGTTTTCAGCTTCAGTATT
CCTGCTACATTGCTAATCGCGTTGATAATGCACACAGAATCTCTAATTTGAACCCTCTTTTTCACTCTAGTCACCGACCT
GCAGGTGTATCCTTCGGCTGTCTTCAACCTCCTTCTGGCTTTTGGCCTGTATGCAGTGCGTTGGCGTCGCCGTCGTCTAA
ACTTGCCAAGACCGGTTTTCCGTGCCTGGGATGTCGTTGTAGGCTTCAGCATTCTCGTCAATGCCTATACCCTGGCAATG
CCGTGGTACCCACCTCCAGGCGGTTCTCATGCCGGTGATGTTAGCTTTTGGTATGCTACGTATATTGTGACGGGAATTGG
CATGTACGTAACCTATTTTCTCTCCATCATTCATTTCCTTGTCTTGTGCCTGCTGACAATTGCAGTCTTGTCGGCTGCGG
TCTTTACTACGCGACCTGGGTATTCATACTTCCGCACTTTCTCGGATATCGCCTGCGTCAGGAGGTCCTGATTCTCGAGA
ATGGTGCCCAGTCGCATAAGCTTGTCAAAGTGCCTACAGAGGATGTGGCGACTTGGGACCGTGAGCACGACGCTGTTGGG
CGACGTCTGAGTGACGGTGACGGGATCGCTGTTCAGCTTGCCGTGGAAGAGAAATTCGACGGAAAAGATGACATAGAGAA
GCTCCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62