GenePrediction:GLEAN_561 Details

Name: GLEAN_561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:617050..619488 (+ strand)
Length: 2439
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:617050..618905 (+ strand)
Length: 1856
Type: CDS
Source: GLEAN
Position: GCSC_97:619458..619488 (+ strand)
Length: 31
>GLEAN_561 class=GenePrediction position=GCSC_97:617050..619488 (+ strand)
ATGTGGTGGGATGCCGCCACGATCGAGCGCACTGTCACGCGACAGTACGTATGCTCCCACCTGCTGCCCGACGAGATTGC
CCGGCTGGACCGGCCGCTGGGCTTTGGCGACGGCCTCACGGACGGCACCTACTGGGAGTGGATCGACGACAAGGCCAAGA
CGATCTTCCTCATCCTGGTTGACCTCGGCGTGCCCGACCAGATCTTTGGCATCATCGACGACTCGTGGGACGACGAGGAC
CTGCCGGTCGACCGCGAGCAGGTCGAACGCCTGGCCCTGACGCCCACCAAGGACACCCGCTTCGAGCGCAAGTTTTTTGA
GCGCCAGTTCTACTACATGCTGACGCCGCTGGAACGTGGCGAGCACGTCTTCTACCACGATGTCGCGGTCGTCCCGCTCG
ACGTCGTCGCCAGCAGCGGCGGCAGCAGCAGCGGAGCCGGCAGCGGATGCAGTGGCAGCGGCGACAGTGGCGGCAAGGAT
CGCGTGGTGCTGTTCAACTATCCCGGTCAGGTGTTTGCACGGCGACGCATCCCGCTGGCACCGTCGAGCGAGTCGCAGTT
CGGATCCGGCTTCCTCTCGTACGAGGACTTCCAGTACGAGGCCAACAGCATCCGCAGTCTGCAGAACGACCACCTGGTCT
CGTACTGGGGCTCGTATGTGCACCAGGGCTATGGCTACGTGCTCTTCACGCCGACCAGCGACGGCAGCCTCAAGTCGCTG
CTGGCCACGACGCCGGCCTCCATCAAGAATCTGGCCAAGAAGGACCGTCGCCAGCTGATGCTCAACTGGATCCACTGTCT
GGTCGATACCTTGTGCTTCCTGCACATGCGCGGGCTCTCGCACGGCAACATCAAGCCGTCGTCCGTGCTGTTCAATAGCG
CGAACCACGTCTTCTTCTCCGACTTTACCCACTTTGGCGCCGAGATGGGCGGTGCCACCGGTACCGGCACCGACAAGGCT
TCGTTCGACAAGGAGTCGTACGACTATGCCGCTCCCGAGCAGTGGTACCGTCCGTCGGGCAGCGGCGGCCACAGCAGCAG
CAGCAACGGCAACGGCAGCAGCAGCAGCAGTGGGAGCAGCCGCAAGAGCCTGTTGACGGGCGAGACCATCTTTGGCCGGG
GCGGAGCCGCGCGAGGGATGGCGATCCACAGCAGCAATGGTGGCAGCGGTGGCAGCAACACGGGAACGTCGTGGTCGTCG
TCCGAAGGAGCTGCAGCAGCTGCAGCGGCCGCGTTTGGCCATCGCGGCGGCCACTCGGCACCGGCCAATCCGCAGCTGAA
CCCACAAGCGGCTGACATCTTCTCGCTCGGCTGCATCATCCTAGAGCTGCTGGGGTTCATGTTGAAGCGGCCGACACGGT
CGTTTGCGGCGCATCGGGCGGCCAAACACAAAATGCCCGGCCGTGGTGGTGCCGTGCTGGACTCGTCCTTCCACAAGAAT
CTGGGCCAGGTTGAGAGCTGGATGGTGGCGCTGGCCCGCGAGGCCGCCGGCAAGAAGAAGGACGACCCGGCTCTCGCTGG
CGTCGCGCCCATGCTGCAGATCGTCGAGCGCATGCTGGCACCGTACCCGGCCGATCGCCTCGCTGCCCTCGACGTCCAGA
CCCGCATGTACCAGATCTTGCGCGACAGCTGTGGCATCGCTGAGCCGCACTGCGTCCACCAGTATGGCACCGGCGACGTC
TGGGATCTCGGGGTCGGCCGCCTCGGCAGAGCATCGCTGCGCATCGCCACCACCAACTATGCCTATCCCCACTCGTCCTC
GTCGGCTGAAGCCGATGCGGCTGCTGCTGCTGCCAACGGCGGCGCTATCTCTCCCCGGAGCACCGACACCGACATCGCCG
CCTTTGCCACCAAGCCGTCCTCGCGCCACAGCAGCATCAGCAGCAGCATCAGCATCGGCCACCATAGCCGTCATCACCTC
AGCCGTCAGCCCAGCCAGTCCGGCAGCCAGAGCAGCCGCAGCATCGGCAGCGGGTCAGCCAGCAGCATTCGTGCCAGCAG
CAGCAGCGGCGGTGGCAATGGCAGCGTGGGCATCGACCTCGCCAATGGCCTGCAGGCCATCCGGAACCTGCAAATCCGCG
ACAAAGTACGATGACAACGGTCGGCACACGAAAAAAACACAAGACACAATCACAAACACAAACACGAGCCACGACAATGT
TTCTGACGACAGCACGGCGTTCCGTGACGCCTCTCGGCGATACACAATGTTTCCAATGATGACACGAGGAGACGGATACC
CCGGTGGAGTTCTGGTATGGAGTTGGCGGATCGGAGGCTTAAAGTCAAATATTGGATAGAATGTTACAGAGTACATCAGC
TAGGCACGGAAAATGAACTCCATGGATCCCCCCCCCCCCCCAAACTGTGGCTTGCCTGTGTGGCGTTCTATCTTGCAGCA
GCGAGCAGCATTCCGGCAGCTGTTGTGGTCGAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62