GenePrediction:GLEAN_5620 Details

Name: GLEAN_5620
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2013353..2012278 (- strand)
Length: 1076
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2013353..2013248 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_173:2012960..2012936 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_173:2012701..2012278 (- strand)
Length: 424
>GLEAN_5620 class=GenePrediction position=GCSC_173:2013353..2012278 (- strand)
ATGCGCCTTACAATCGAGGGCAACTACTGCCTCTGCCCCAAAAACGATGGCGCAAAGCGGGTCCTCGACATGGGCACCGG
AACGGGCATATGGGCTATGGAGTACTGTGTGTCTTCCCTTGCCGCTTCGAAGCTGACTCTTTGCTGCCAACTACTTGCAA
CTAACTCTTCACCAGCCGATGCCCATCCTGATGCGGAGGTGTCTCTCCCTCCCCTTGTTTTTCGTCTCGGTCGCTAACGC
AGACTTGTGCTACCAGGTCATTGGAGTCGACCTGAGTCCTTTGCAGCCAGAATTGTGTGATGCGCATTGTTTCTTGCTTT
CTTCGCCCCCCCCCCCCCCCGGGGGAAAGTTTCGTCATCAATTTCTAGTGAATTGCTAACTGTTACATTTCAGTGTCCCA
CCCAACTGCTCCTTCGAAGTGAGCCCAACTTACTCAAATCCTCTGCCGTGTCACTTGATTGACTTTCACAGATCGACGAC
CTCGAGAAACAATGGACCTGGAACAGACCCTTCGATTTTATTTTTTGTCGAATGATGGCTGGCAGCTTTTCTGATAACAA
GAGCATCGTGCAGAAGGCTTTCAAGTACGCCTGGTTACCACACATGTCCGATTTACCACAGAAACTGCAAAACTGACACT
TGGTATTTCCAGTCACTTAGAACCCGGGGGATATTTTGAAGCTCAGGATATGAGGCTACCTCTCGAATGTGACGATGGAA
CCCTCAGAGAGGACTCAGATCTGTGGATCTGGATGAGTCTGGTCATGGAGGCCATGGAAAATCTCGGTCGACCGGTCGTT
GCTGCGCAGCAGTGGAAGCCATTTATGGAAGAAGTCGGCTTTGAGGGTGTCGTCGAAGTAAACTACAAATGGCCCATCAA
CCGCTGGCCTCGCGATAGGAAATACAAGGAGCTTGGCACCTGGAGTCTCGCCAACATGGACCAGGCCCTGGAGTCATCTA
CTTTGGCTCCGCTGACTCGCGGTCTCGGTTGGTCCCGCGAGGAGGTTCTGGTACTCATCAGCAAGGCCCGTAAGGTCTTA
CGCGACACCAAAGTGCATGCCTACTGGCCAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62