GenePrediction:GLEAN_5621 Details

Name: GLEAN_5621
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2009307..2008587 (- strand)
Length: 721
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2009307..2009286 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:2009214..2009074 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_173:2009006..2008900 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_173:2008823..2008587 (- strand)
Length: 237
>GLEAN_5621 class=GenePrediction position=GCSC_173:2009307..2008587 (- strand)
ATGTCTGAAGCGCACACTATCTGTAGGAGAATCGTCTACTGCCCAAGCTTTCTGGCTTAACATATGGCCCATTATTAACA
CAACGTACCGCAGACTATAGCCCGGCCCTTGCCCGCGGCTCCGACGGAACGACGTACGACCAGCAGTCGATCGAGCTGGC
CATCTCCACGGCCCTGGAGCTGCTTAAGGCCGGAGCCCAGGTTGGGGAGGGCAAGTATCCGCATGCGTATAAGAGTACGA
AACTTCGTGATTCTCCCTTTTCCCGCCTATATAATGAGGCTAACGCTCCTCTTCTGTACAGCGTACCCATACTTCCACGT
TGAACATGCCGTGACACCCATTTTTGAGTTCCCCGTTCTCAAGGAGCAAGCCTACGACGGCAAGGCTAGTGCAGGGATTG
ACCGTGTGGTACGTTGAGACATGCCGCCTTGTTCAGTCTTTATTCTATCAAGCCAAGTATGCGTCTGACTCCAAATACCA
TCAGGTCTTCGGCTCTGTCTCCAAGGACTACCTTTCGGCCAACTACATTGGCATCGTTGGGTCCAAGGACGGCAGCGTTC
GCTACCTCCACAACGACCTGTCGCTCAATGGCAAGACTGGTGTGGGTGAGCCGTTTACGGCGCAGGAACTGGCTGAGTTT
GGTGGTAAGCAGGTCCTTTCGCCGCCGGCTGATGCCGATACTATTGGCAGCGGCGACGTGAAGGTCCATTATCATAACTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62