GenePrediction:GLEAN_5623 Details

Name: GLEAN_5623
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1998471..1996847 (- strand)
Length: 1625
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1998471..1998138 (- strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_173:1998076..1997858 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_173:1997785..1997730 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_173:1997667..1997498 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_173:1997420..1996847 (- strand)
Length: 574
>GLEAN_5623 class=GenePrediction position=GCSC_173:1998471..1996847 (- strand)
ATGGTAACCCCGTTTGATCCTAGTGTCGACTACTATCCGCCATCAATCCGTCAGAAGTACGGCCTTGGCGACTTTGACAA
TGTGAAGTCTCCGCCTGCCGAAGCCGTGCCGTCGGCTGATATAGAGTGGCTCCCGGACTATTTAAAGTTCGTGGAACGAA
TTGAAGCACATGTCAGGGACGTGGATTCCAATGGCGCCGGGTCCAAGTGCCGGGCCGTCGGTCTAGATTCCCCTTTGGCA
TGGAGTGGACGAGAGCTGCAGTTGCAAGACAACATAGTCCCGCTGGACGAGGCTGACGTGCAAGAAATTCAGTCTGCTAT
GGAATTCTTTAAGGGTATGTTTGGCGTCATGGGGAAACACTGCGGGACTAACCCAGCCAGCAAACGAAGATTCAGATCTT
TCGTCTGTGAAAAGGGATACATTTCCGCTGCCTAATCTGGGCCCTCGACTTAAGAAGCTATGCTCCGGTGTGTACAACAA
GAAGGGTTTCTGTATTCTCCGAGGGTTGTCTCCAAAGTCCTACTCCCGCGAAGACAATGTAATAATCTATCTCGGTATTT
CCAGCTACTTTGGAGAGCAGCGTGCAAGGCAGTACCCGGATGGATCCAGCATCGGTACGTCTGTAGACAGAAGAGTTGGG
CAAAAGGAGAGAAAATTCTGACAGGAATTTACAGCGCACATCACAGATGTCCGATTCGACGAGGTCGCAGACAATAAGCG
CAGGCCTGCGTTCACCAATGCTGTCCAGGCAAGTGAACTTCGTAAGAATCGCAGTTCCTATGCCATCCTGACCGGTGCCT
GCAGCCCTTCCACACGGACTTACTTTGTAGCTTGTTGGCCATGTACTTTCTCGATACTGCTGCCAGCGGTGGCGAGATCC
GTCTGGCCTCTTCGTTTAGGGTTTACAAGGAGATTGCCGACAGGCTGCCAGATCTCATCAACGTTCTTGCCAGTGATGAT
TGGGTCCATGACACGTAAGAGAATGCTAAGAGTGCAGCACGTTTCTGTAGCTGATCTTCAGATTTGGACGCAATCCGCCC
TTTCTCCGGAGGCCGCTGCTCCATCTTTGGCAGGACAAGCCCGTCCTCATCTTCTCGCGCCGGAACCTCACTGGCTCTAA
AGCGACACCGCGCTCCTTGGAGATTCCGCCGATGACGGAAGCACAGGCCGAGGCCCTGGATGCAGTCCATTTTATAGCAG
AAGAGCACTGCGTCACCATCACCCCTCAGCCTGGCGATATGGTGTTCATCAACAACTTTGCCGTCATGCACAGCCGCAAT
TCATTTCAAGACAGCCAAACGTCCAAGCGCTATATCCTGCGGCTTTGGCTGCACAACCCGGAAGTCGGCTGGGATGTACC
CCCTGGGCTACGCTTGGCCTGGGACCGTTTATTTGAACGTGTCGACGAGATCGTCAACTACTGGGATATTGACCCGTACT
CGGAGCGAGGGCGCTCCCTCTACCGCAAGAATCGGACTTTTGGTGCTACAGACGGCGGCGAAGGCACTGGTGGAGGCATT
AGTGGAGGCGGTGGTGGTGGTGGTGGTAGTGGCAGTGGTGGAGGCGGTGGTGGAGGAGGTGGAGGTAAAGGTGGTGGCTA
CGGCTATTCCTCCTCGTGCGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62