GenePrediction:GLEAN_5625 Details

Name: GLEAN_5625
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1981633..1978936 (- strand)
Length: 2698
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1981633..1981385 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_173:1981334..1980997 (- strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_173:1980937..1980344 (- strand)
Length: 594
Type: CDS
Source: GLEAN
Position: GCSC_173:1980269..1979904 (- strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_173:1979773..1979667 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_173:1979616..1979344 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_173:1979285..1978936 (- strand)
Length: 350
>GLEAN_5625 class=GenePrediction position=GCSC_173:1981633..1978936 (- strand)
ATGGATTCCAAACGCAGTAGATTGTCGGTGAATCCGATAACATTGGGGTTCCAAATCTGGCAGCGCGCACTCGACTGGAC
TCTGTCACCCAAAGCTCCTGACCCAAACACGAAGCTTCACCGGCCCAGAGTAGCCGTGATTGGAGCTGGCATCACTGGAA
TAACATCTGCAGCACACTGCATTGGACACGGATTCGATGTCGCCATTTTCGAAGCTGGGGGGGAGGAGAGCATTGGAGGC
ATCTGGAGTGTAAGCATCCCGAATCCATTTCATTGAAATCATGGCTGACAAGTGCGCAGAAAGTCAACGATACCTCCGGA
CTCCAAATCAATGCTGCCATGTATCGCTTCCACCCTTCCGTCAACTGGTCGCGTGGCTATCCGAACCGGCAAGAGATCGT
CGAGCAAGTCAACATCCTTTGGAAACGCTATAAGCTGCCTGCACGCACACACTTCCACACGCCCGTCAGCAAGGTGTACC
GGAACGAAGCAGGACAATGGATCATCAACGAGCCGGCCAACGGGACCTTTGACGGCGTCATTGCCGCCGTCGGAACATGT
GGAGACAAAAAGATGCCACACATTGAGGGCATAGAGAGCTTCAAAGGCTCTGTCTTCCACTCGAGCATGCTGAACGGGTA
AGTTCCGAACCCTGACCCAACCGCCCTTCTTGTTCTGAATCTGTACTGCCACACAGGGAGTCTGCAAAGGACAAGAAAGT
GGCCATTATCGGCGGTGGTGCGAGTGCGGTAGAAGCCCTCGAATTTGCTAGCAAAACAGGCGCAGCAAAGACGTACATTT
TGTCCAGGAGCGAGAAGTGGATCATCCCGCGCAACCTCTTTGCCGACATTCTGTTTTCACTCAACATCTGGGGCCAAGAG
ACGATTCTCTCCTGGATCCCGGAGACGCTGCTGCGCACGTTCTTCTACGGCGACCTCAAATCCATCGCGCCTCCAGCCGG
CTCAGACTCGGGCATCTTCACCAACACGCCCATGGTCAACTCGGACATCATGGAAAAGCTGCGGGACGGCACGGCCGAAT
GGGTTCGTTGCGACATTGAGCGGATTGTAGAGAACGGCGTCGAGGTCAACCGCCGCGCCCAAGGCGTGCCCAAAGGCGGC
CCCGGACGGCAGCAGGTGGTCGATGCCGACATGATCATCATGGCAACCGGCTTCAAGCGGCCACCGCTGTCGTTCTTGCC
CGCAGACTGCTTCGAAGAGCCGTATGCGGCGCCCAACTGGTATCTCCAGACCTTTCCGCCGAGCCATCCGTCTGTGTCGG
CTATTAATTGGTAAGCCGCCTGTGTGCATCGGCCCCGGGAGACAAGAGTGAGACCGCTGCTCTGTTTGCTGACCACGGTT
GCAGCACCTATGTGGCCGCCATCGGGACGGTTGGCAATTGGCACATTGGCATCTACACGCGCATCCTACTCATGTTTCTG
GTCGACCCGCTGACACGGCCGAGTCGTTTCTGGATGACGCGCTGGATCGATATGACCTGCTTCCTCAAGGGAAACTCGCC
CACTAAGGCTTTCGACTTCTTCACGTACTTGGAGCTACTGTGGTGGTTCCTGTTCTGCGTCGTCATCAACCCCTTTCGCT
GGAAGTGGGCAGTCTTTGTCTTTTTCGGCATTGGCCTGGGCCTCCCAAAGGCCATCAATCGAGCGGAAGCGCGCATTCTG
GCACGTGCTGGATACAGCAAAGATGAGCGTCGCGACCAAGGGAAGAGCCTGTGAGGCCCGAGCGATGATGGCTGGAGGGG
CAGTAAAAATAAAATGGTTATTTACGAGGCTATGATGTAATTAAAGTGTCGCGCATCTCTCGATCCAAGCGTTGTATCAG
GCTAAAACCAATGACGTCAGCGTGTTTACTGCCTCTGTACTCCGTAACCTCGCGCCAGAACTGCAGCCGAGCCTTCTCAG
ACACGACACAACATACGCGCAAACAGAAGCCGAAATGAACAATCCTGGTACGAGACACGGCCGCGCCGTCATTGCGTAGT
AGCTGACCATTGCGCAGTCAAGGAGATCCCTGCCGTCATTCTATCTCTTTGCACTCGGCCGCAGGCAGAGCAGGAGGCCA
CCATCGACCGATACTTTCTGAAAGACGCCTCGTTTGTGCACCCGTTCTGCTACGTCCCCCCGATTGCGACCCTCTACGAC
ATCGTGCCCTGGCCTTTCTCACCAGTCGTCGGGATCACGGGCGATATCAACTCCCGTCGCATCGTTCGGGCCATCTTTCG
CTGGTACAAGATTCTTAGCCCGGACATTGATATCGCTATTGACTCCATCGGTTCGTTCGCACACACACACCTGCACGGCC
TTCTGCCTGGCTGACTGACCTCCTTTAGCCTGGGACGAGGCACAATGCATCCTGTACGTGAGCATTCACCAGCGCTTCGC
TCTCTGGTTCGTCCCGTTCTACGCGGCCAAAGTCCATCTCATCACTGAGCTCCAGCTGGAGCCCGTAGGCGAGAGCGGCA
CCGAATCCCGGCCGGTCTACTACATCTCCCGCCAAGAGGACCACTATCAGCTCACCGAACTCCTCAAATTTGTCCTGCCC
AAAGTCGGTCCTGCTTCTTGGACCATCTGGCAGCTTTTTTCTACCTGGCTCTGCTATGTCGGCGTTTTGTTTGTCGACGC
AGTATTGGGTCTGTTCGGCAAAACGAAGCTTTTGCCTTGGCGGAAAAACCATGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62