GenePrediction:GLEAN_5627 Details

Name: GLEAN_5627
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1967240..1965495 (- strand)
Length: 1746
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1967240..1966996 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_173:1966932..1965495 (- strand)
Length: 1438
>GLEAN_5627 class=GenePrediction position=GCSC_173:1967240..1965495 (- strand)
ATGCGTTTCCTGTATAGCTTCGGTCAGCTTGTGGTTGGCCTTGGAACAGCCACTGCCACTAACGATTGCAAATGCTTCCC
AGGCGACGGCTGCTGGCCTTCGACAGCCCAATGGACACAGTTAAACAATACTGTCGGTGGTCGTCTGGTTTCCACCGTCC
CATTGGGAAAGCCATGCCATGGCGACGACTTCAACAAGACGCAGTGTGACTTGCTGAAGGAGCAGTGGCTTTTACCGCCT
ATCCAGTGAGTAATCTGTCCTGCGAGCAGAAGCCAATAGCAGCACGAGCCCCTGCTAACGAGACGCAGCTACGAGTCGTC
CTCCTCGATGATGGCGCCGCTGTTTGCCAATGCCAGCTGCGATCCGTGGCAGCCCGTCGAGCGGCCATGCATGCTGGGCA
ACTACGTAGACTATGCCGTCAACGTGACGTGTGCAGGCGACGTCCAGGCCGCTCTGGCATTTGCCCGGACGCACAATGTC
CGTTTCGTGATCCGCAACACCGGCCACGACTACCTGGGCCGCTCCACGGGCGCGGGCGCTCTGGCCGTGTGGACGCACCA
CCTCAAGAGCACCGAGATGGTCGACTGGGCCGACGAGTTCTATACAGGCCCGGCTCTGCGCATGGGTGCCGGGGTCCAGG
GCTTTGAGGCCCTCGCCGCAGCCCATGCCGCGGGCTATACTGTGATCACGGGCGAGTGTCCCACTGTCGGTGTCGCCGGA
GGTTACGTGCAGGGTGGCGGCCACTCGGCCCTCAGCAGCAGCTTCGGTTTGGCCGCTGACAACGTGCTGGCATTTGAAGT
TGTCCTTCCAACTGGCGCACATGTCGTCGCCACGCGCCACCAGAACGCTGACGTCTATTGGGCGCTAGCAGGCGGAGGCA
CCGGAACTTACGGTGTCGTCTTGGCCGTCGTCACCCGGGCGCTACCAGATGCTGTCATCAGTGGTGCCAAGCTTGCCATC
ACGACGCCCGCTGACCGTCCCGAGCTCGTTTACGTCGTCGTCGACGCATTCCACGCAGCACTACCCGGCATCGTCGAACA
CGACACCATGGTCATCTACTACTTTGGCACCGGCTTCCTCAGCATCCCCGCTCTCACAGCCTACAACAAGACGCGCGTCG
AGGTCGAGTCTATGCTGCAGCCGCTTCTCGCGGCCTTTGTGGCGCTCAACCTCACCGTCGTGCCGACCTACACCGAGTTC
GACAGCTACTACGACCACTACGGCCATTACTGGGGCCCGCTGCCTGCCGGCAACATCGAGGTCGGTGCTAGCCTCTATGG
AGGTCGCCTCATCTCGGCCGCGCAGGTCGCCAGCTTCTCGCCCACTAGCCGCGCCTTGATCGACCTCGGCGTGACCCTTA
TTGGTGTCGGGCTCAACGTCAGCCGCTTCGCCGACGGCAGCACCAACGCCGTGCTGCCCGCCTGGCGTGACGCCCTCGTT
TCTGCGTCGCTGACATACAGCTACAACTTTACCGCACCCTTCTCCGACATGCGGGCGCTGCAGGATCATATCACCGCCGT
GGTGCAGCCTGTCATCGAGGCTGCCACGCCCGGCTCCGGCGCCTATTTGAATGAGGCTGACTTCCAGCAGCTCGACTTTC
AGGACGTGTTCTACGGCAGAAACTACGACCGTCTGCTGGCTATCAAGAACGCGCTTGATCCCGACGGCCTGCTGTACGGA
CACACGGCCGTCGGTAGCGAGATGTGGGCCTTGGCAGAGGACGGCCACATGTGCAAAACAGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62