GenePrediction:GLEAN_562 Details

Name: GLEAN_562
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:620312..624577 (+ strand)
Length: 4266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:620312..620447 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_97:620515..620729 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_97:620793..621744 (+ strand)
Length: 952
Type: CDS
Source: GLEAN
Position: GCSC_97:622591..622601 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_97:622676..622973 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_97:623044..623891 (+ strand)
Length: 848
Type: CDS
Source: GLEAN
Position: GCSC_97:623957..624577 (+ strand)
Length: 621
>GLEAN_562 class=GenePrediction position=GCSC_97:620312..624577 (+ strand)
ATGAAATTCACATCTGCCATCAGCGCCGTGCTCGGCGCTGCTACCTCTGTAGCTGCTGCTTCCGACAGCCTGCCAACAAT
CACGGCTGTGGGCAGCAAGTTCTTCCTCAGCAACGGCACCCAGTTCTTCCTGAAGGGTTCGCTTCTCTCTCTGTCTTTTT
CCCTTTTGTAGTCTTCCCCTCGTTCCACCCTAACAATGCATAGGTGTCGCGTACCAGCTGTCCGATGACGACCCGCTGGT
CGACGAGAAGCAGTGCACCCGCGATGCCGCCTTGATGAAGACCCTAGGGGCCAACAGCATTCGCGTCTACCACGTCGACG
CTTCTGCCGACCACTCGGGCTGTATGACCGCCTTTGCTGATGCTGGCATCTATGCGCTCATCGACCTGGACACCTTCAGC
ACATACATCCTGTCTCCCGTACGCTCCCGTTTATCAATACCTTTTTTTAGATTCTTAAGCTAACCCGGCTTTTCTCCCCA
GACAATGACCGATGCGACGTGGAACGAGACTCAGTTCGACCGCTTTTCGGCTGTCATGGACGCGTTCTCCAGCTACGACA
ACGTGCTCGGCTTCTTTGTCGGCAATGAGGTCATTGCCAAGGCCGACGAGTCTCTGGCCGCCCCCTACATCAAGGCTGCC
GCCCGCGACATGAAGGCCTACCGCGATTCTAAGGGCTACCGCAAGTTCCCTATCGGCTACTCTGCCGCTGATATCGCCGA
GCTGCGCCCCATGCTCCAGGACTACCTCACCTGCGGCAACGCGTCCGACTCGGTCGACTTCTACGCGCTCAACTCGTACG
AGTGGTGCGACCCGTCCTCCTACACCGGCTCTGGCTACTCGTCTCTCGAGTCGCAGGCTAAGGACTTCCCGGTGCCCATC
TTCTTCTCCGAGACCGGCTGCAACACCCCGGGTCCCCGCTTGTTCGCGGACCAGGCCGCCATCTTCGGCGACCAGATGGT
CGACGACTGGAGCGGTGCCATTGTCTACGAGTGGATCCAGGAGGCGAACAACTACGGTCTCGTTGCCTACGGCTCTGGTG
ATGCCACTGCTAGCGGTGCGACCGTGGTGCGCAGCGGCACGCCGACGCCCATCTCGCCTGACTTCAACAACCTGAAGTCT
CAGTGGGCCACGCTGACGCCGACGGGTGTTGTCAGCTCCAAGTATAATGCAGCCTCGAGCGTGTCGTCACGTGCGTGCCC
TGCCTCGACCGTCAGCGGCTGGCTCGTTGACGGCGATGTCTCGCTGCCCACCGTTGGCGATTCGCTTGCCGTCCACACGT
CAGGCCAGAGCGGCAGCGCGGCCACTGCCAAGACGACGAGCGCGAGCAAGACAGGCACCGCTACCGCTACCGGCACCAGC
GCCAGCGCCTCAGCTTCGGCCACAAAGGCTTCGAACGCCAATGCTATGGGTCGTGGCGTGATTTACACGAGCGGTGCGTT
GGCCGCCGTTGCGCTCTTTGCTCTGTGGTTGTAAACAGTGCAGTCTTTCGAAAGCCGGATGCAGTTTTACGTTGAATTTT
GGACGACTTTGGACACGAAGCATAGCAATACCGACATTAGATGTGCCTTGCTTTCCTCTCATTCGACTTCTGTGTTTTAA
AATACTAGCTATTTTGTATGAGCAAGGAGTCATGTTGTACAAGACGTGATCCAAGACAGTGGGAGTATAGACTCCTATAA
TAGTATGACTCGTTCCTAGAGATAAATGCCAGTGTACAAGGAGGTTTTGTGAGACAGCCAACGTTGGCGACCATCGGCAG
CTTGACATTTGTTTACAGGATGAGGAGCATCTGTGGATATGCGTGGAACTGGGAGCTTACGGAGTATGTAGTACGACGTA
TGCTCGCCTAATTCGGTGGAGCTTCGCACGTCCCCCTCAACCTCCATCTGCAAGGTAGTTGAAGAGGCTTTAACAAAGTA
CTCCGTAGTCTGTTCTGGAGCTTCTCGTGGGGCCAAAAAGGCGGTATGCCTAGACGACAACGCATCTTGTCAGGAAGTAC
GGGGTAACGATGGGCGATTGCTCCGTAGATGGGCCGGAAGACGACATGGATAGGAGAGTGCCTTACTATACTATGTACAG
GAAACAGGCGAGAATACAGAGTGCTGTACGCTGTACGCCTTTTGCCTCTGCGTCTTGAGTTGCTTGGAGCTGTTCCTCAT
ATGCCTTGAGAGACTAGTCTTGTAGCGGTTAGCCAGTTGTGAGACAGCCCCGTAATTGGGGGCGACGGGAATGTTCTACG
AGTGCTGCCTACACATACACCATACTCCGTAAACAGCAGGAGCAACCGGCGTACGTCGTAGCGGCTTTCCAGACGACAGC
AGCAAGGAATCCCATCGAATTCAGCGAGCATCTATTTTCCACAGGTCCACCTGACGATCCCTCCGACTTGCTTATCTTGT
CGCCACCGCCTCTGGTGCATGGAACGCGGCTCGGCCGACGCCACGGAGCTGTACGAGTACGAACATAGCAGCGGTGACGG
CATGGCAGCACGCGACGACGAGCAGCCGCTGCTGGCGGACGAGCAGCCGAGCGGCCGGAGCGACCGGACAGATGCGGAGC
GGCTGCTGGGAGGCGACGACAGCAAGAGCGGGCAGCACGGACCCGGAGTGTTTGTGTGGCTGCTGACGTTGTCAGCAGGC
ATCAGCGGGCTTCTGTTTGGGTGTGAGTTTGTTTCGATGTGTTCGTTTCGATTCGATTCGTCTCGTCTCTGACCTGTCTC
TCTCTGAGCCAGACGACACCGGCGTGATCTCGGCCACGCTCGTCTCGATCGGGTCGTCGCTCTCGGGGCGGCCGCTGTCG
TCGCTCGACAAGTCGGTCATCACGTCGTGCACGTCGCTGGCCGCGCTGGTGGCCTCGCCGGCGGCCTCGGTGCTGGCAGA
CGCGCGCGGCCGGCGAGCGGTGATCCTGGCGGCCGACGTGCTCTTCGTGGCGGGCGCGCTCGTGCAGGCGGGCAGCCACA
CGGTCGGAGCCATGGTGGCAGGACGGTCGGTCGTCGGCGTGGCCGTGGGCGCGGCCAGCTTCGTGGTGCCGCTCTACATC
GCCGAGGTCAGCCCGGCAGCCCATCGCGGCCGGCTGGTGACGATCAACGTGCTCTTCGTGACGCTCGGCCAAGTCGTCGC
CTACGTGCTCGGCTGGCTGCTGGCCGCGTTCCTGGACGTCCGTCTGGCCTGGCGCTGCATGGTCGGTCTCGGCGCCGTCC
CGGCCGTCGTCCAGGCCGTCCTTCTGCTCGCCTCCATGCCCGAGTCGCCGCGCTGGCTCGTCCGCGTCGGCCGGCCTGCT
GACGCCCGTCTGGTCATCGCTCGCATCCTCGCCGTCCCCCCCGACGCTCCCGATACCGTCGACACTCTCCGCGCCATCGA
GGCTGAGGTCCGCCAGGAACACGAGGCTTCCCGGCTGCGTCACCACCGACAGCTGCAGCGGCGCAGCGCCCGACTCACCA
CAACCTCGATCCCCATCCTCTCTCGCCTCGTCGCCCGGCTCGACGGCAGCGCCTGGTCCGCCCTCTTCGCCGTTCGCCGC
AACCGCCGCGCCCTGGCCATCGCCTGTCTGCTGCAGGGACTCCAGCAGCTCTGCGGCTTTGTACGTGCTACTTCTCCTCG
TTTTCGGTGCCTCCTTGCCAGCGCTTCCCGCTAACCTGCCCCCAGAACTCGCTCATGTACTTCTCTGCAACGATCTTCTC
CATCGTCGGCTTCGACCAGCCCACGCTCACGTCGCTCACCGTGGCCGCCACCAACTTTGTCTTCACTGTGGCCGCCCTGC
TGCTGGTCGACCGCATCGGCCGGCGCCGCGTGCTGCTGTGGTCCATCCCCGTCATGATCGCAGGCCTGCTTCTGGTGGCC
TACGGCTTCTCCTTCCTGCATGTGTCCGTGTCGGGACCACGGCCGGGCGAGTCGGACAGCCGGGCAGCAGAACACGGCAC
CGGCGCTGCCTACGTCGTCCTGGTCAGCATCATGCTTTACGTGGCCTCGTACGCCATCGGTCTCGGCAACGTGCCGTGGA
TGCAGAGCGAGCTGTTTGCGCTCGACGTTCGCTCGCTGGGCAGCGGCCTGTCTACAGCCACCAATTGGCTGGCCAACTTT
GCCGTCGGCCTCACCTTTCTGCCGCTCATGGACGCCCTATCGCCGTCCTGGACGTTTGTGCTGTATGCCGCCGTCTGTGC
GGTCGGCTTCGTGCTGGTGCGCGCCTGCTACCCCGAGACCAGCGGGCTGAGCCTGGAGGAGGCTGCCGGTCTGCTGGAGG
AAGACGACTGGGGCGTGCACCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62