GenePrediction:GLEAN_5631 Details

Name: GLEAN_5631
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1946039..1944916 (- strand)
Length: 1124
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1946039..1946003 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_173:1945946..1945519 (- strand)
Length: 428
Type: CDS
Source: GLEAN
Position: GCSC_173:1945452..1944916 (- strand)
Length: 537
>GLEAN_5631 class=GenePrediction position=GCSC_173:1946039..1944916 (- strand)
ATGGCGCAATTATCTGGGTTGTCGATGTTGGTCCGAGGTACGAAGACAACTGAACCCAACAGTATCGTGCGGAAGCTGAC
TTGTGTATTCCAGCCACGGCCATCGTCATCGGCGCCACGGCCGTCGCGGCAGCGGATGTTGACGGGTCCCCGGATACCCT
AGCCAAGCGCTACTACGGCCCCTTTGGCAGTGGCAGCTATCCATCTAGTAGCGGAGGAGACAGTAGCGGTAACGGCGACA
GTGACAGCTTCTTCGGGAGCAGCAACGGCTTCCCAGGCATTTCTGGCTCCACACTCGAAAAGGCCATACATTACCGCACA
GTCCACGGCATCCTGGCATCTCTGGCTATCGTTGTGCTCATGCCCGTAGGCGCCATTCTGATGCGCATTATCCCGGGTCG
CTTCGCCATCTGGATCCACGCTATCGCTCAGGTGCTCGCCTACCTGCTCTTTGTTGCTGGTGCCGCCCTCGGCCTCTATC
TCGTCAATACTGTCCGGTTTCCCTTTTCGGGAGGCAGTCTGGTGCGTGGTCTCCCCCTTTGTCTCTGCTGTGTATCTCTG
TTCCGGTTGCTGACAGTGTCGCTGCAGCTCAGCCTGTCGTCTACGAACGCGCACCCGATCATGGGTATCGTCACGCTCGT
CTTACTCTTCTTTCAACCCATTTTGGGCTTTGTCCACCATGCGCGCTTTAAGAAACTTGGCCGCCGCACTGTCTGGTCGT
ATCTGCACCTCTGGAACGGCCGCATCGGCATCTCTCTTGGCATCGTCACCGGCGGGCTCGGCCTGCGCCTGGCCCATGCC
TCGCGCTCCGCCAAGACCGCCTACATCATCGTTGCCGCCATCGTATGGTTTTTCTGGTTCGTCGTCGCCGTCCTCAGCGA
GTTCCGTCGCGGCCGCCGGAGCCGACGTGGTGGTCCCACTGCTGGCGTCACTGTCTCGCCGCGACCGTCGTCCCGTCGCC
GCGATAGACGTGTCAGTCGGGATGGATACTATGGCCACAGTTCCGACGGCAGTCCCGTGATGTCTGCGGTGGAGCCGTCC
CACAGCAGCCGCATCCACCGTCACCACTCTCCCAAGGCCAGCGAGTCACGGAGCCGAGGGTCCAGTGCTCGTCGGTACGT
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62