GenePrediction:GLEAN_5632 Details

Name: GLEAN_5632
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1940171..1938649 (- strand)
Length: 1523
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1940171..1939947 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_173:1939890..1939764 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_173:1939689..1939566 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_173:1939489..1939032 (- strand)
Length: 458
Type: CDS
Source: GLEAN
Position: GCSC_173:1938971..1938649 (- strand)
Length: 323
>GLEAN_5632 class=GenePrediction position=GCSC_173:1940171..1938649 (- strand)
ATGGGCTCTGTTCAGCCAGCAAAGGGGGGTGTCGATGTCTCGATCGCTCTGGCTCCCTGCAACATAGACGTCGTTCCGAA
GCTGATAGAAGAAATTTCGCGGCGGACTGCCTCGGCAACTTCTGGGGATGAGGCCGCTCGCCTGGAGCTGGCTGAGAAGG
CCCGATCGCTTGTCAGGGCCCTTGAGACACCGCGAGAGACGATGATCAAGCATTGCTGGGCTCAGGTGCGCATAATTCGG
GGCTCACCTGAAAGGGTTCGCCATGCTGACAAGCCGGAAAGCCTACGGTCTTCACAGCTATAACGTTCGGGGTCGATATC
GGCCTCTTCAAGTTGCTGGCAGAAAGTGACGACGTGCACAACGCCTACGACCTGGCAGAAACGCTCGGTGTCGATCCCCC
TCTCCTCTGTATGCATTGGACTCCTATTGCTCCATATTGTGATACGCAAGCTGACCGGGGTCGGTCTTCCCCTTTTTCTA
AGGCCGACTCCTACGCCATCTCGGCACGATGGGATACCTCACGGAAGTAGGTCCCGACCAGTATCTGGCTACCAATTTTG
CAAAGTCTCTCAGCATCCCCATCATCAGCGACGGATACCCCTGCATGTAAGATTGCGCTCTTCCGACAATGATCTAGCCC
TTCGTCCGACCCCTAAAGCAGCTGACAACCTGGTAATCTTAGTGGTGGCGGGCTGTCCCAGTGCATCTTCCGTTTCAACG
AGTTCGCAAAGCACAACGGCTACAAGACGCCCACAGACGTGTCTAAAGGCGCGCTGCAGTACGCCTACGCCACAGAGAAT
AACTTTTTTGAGCATCTACATAGCCATCCGCCCTACGGCATACAGTTCAACAACCACATGGGTGGCTACCGTCAAGGCCG
TCCTTCATGGATGGATGACGGCTTCTATCCGGTCAAGGAGCGTCTTGTAGACGGAGCTGACACCAGTCCCGAGGCCGCGT
TTATCGTGGATATTGGTGGGAGCCTGGGCCACGACATTCGGGAACTACACCGCAAGAATGGCAGCCTTCCTGGACGTCTT
ATTCTCCAAGATCTGCCTGTTGTGATTGGTCAGATTACGGATTTGGATTCCCGGATTGAGAGGATGGAGCACGACTTTCA
CCTGGAGCAGCCCGTGAAAGGTAGGTTGTGTCGTATTTCACAGTAGTATTTGCAGACACTAACGATATGCTTCAATACAG
GTGCCCGTGCTTATTACATGCACTCGGTCCTGCACGACTGGCCTGATGAGGTTTGCGGGAAGATCCTGGGTCGCATCAAG
GAGGCGATGAAGCCGGGCTACAGCCGGCTCCTAGTCAATGAGAATGTGATACCGCCTGTGAAGGCGTCATGGGAGGCGAC
AGCACTTGATATCATGATGCTGACACTTTTGAGCTCGCGCGAGCGGACGGAGGCTGATTGGCACCACGTTCTCGAAGATA
TTGGTGGGCTGAAAATCACCAAGATTTGGACGGCAGCCAATGGAGTGGAGAGCATCATCGAATGCGAGCGGCCGAGTGCA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62