GenePrediction:GLEAN_5633 Details

Name: GLEAN_5633
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1937886..1935110 (- strand)
Length: 2777
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1937886..1935899 (- strand)
Length: 1988
Type: CDS
Source: GLEAN
Position: GCSC_173:1935811..1935447 (- strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_173:1935381..1935110 (- strand)
Length: 272
>GLEAN_5633 class=GenePrediction position=GCSC_173:1937886..1935110 (- strand)
ATGGCGTCTGAAGCACGGCCAGACGCGATCGCGTCAGCATCGGTGCCGGCGTCCTTGTCGGCGGCAGCGGCGGCCAGCGG
GCGCAAATACCGATCCAAGAAGCAGCGGCCGTGTGACCTGTGTCGATCGCGCAAGATCCACTGCAAGGTGGGCATCAGCG
ACGCCGTGTGTGAGTGTTGCCGACGGCTGAAGCGCGTATGCACGTTTGAGATGGAGCCGCTGAAGCGACGTCACCGCCCA
GAGCAGCCGCAGGGTATCATTCCACAAAACAGCCTCACGAGCGGTAGCCTTGCGGGGTTGCAGGGGCTGTCCAACCTGCC
GGGGCTGCCGCCACCACTGCCGGTACACACGTCGATGGCAGCCGATGGCAACAGCAGTGGCGTGGTGATGCTGGACTCTG
GGCAGATGGGCGGCGGTGCAGCCGACGCGGCCATGGCGCTGGACATGGGCACGCCTTTCTGGTTGAGCAGCACGGGCAGT
GGTGGTGGTAGTAGTGTGGGCAGCGTTGTCGGAGGTGGAGGTGGTGGTCATGGACACGACGGGCCGACGGCATCGGAATT
CTTCAGCCCACGTGGACTGTCTGAGATGGAGCAGCTGCTGCTGCAAAGTCCGCTGGCCGTGATGGCGGCAGCAGCAGCAG
CAGCCGAGGAGCCGGGCACATCGCCGTGCAGCGGGACCGAGGGGACCAGTCCTCCGGCCCGGAGCAACAGCATCAGCATC
AGCGGCAGCAGCAGCATCCGCAACGGTGTGGAGGCCGTGCTGGTGGGCTCCAGCGGAGAAGCGGCAGAGCACGAGACGCT
CGGCAGCATCGAATTGCACGCCCTCGGCTCACATCAACGGCCGGCCGACAGCCCGGTGGCGCCGTGGGTGTTGCCGGACT
GGCCACAGGAGTTTTCGCTCGAGGGCCGGCAAGGCTACTCGAACCACTACATCGGGCTCTCGGGCGAGGCCGACCCGTTC
CTGCTGCGGTTTTACGAGTACAACGGCCACGACCTATACACCATGTTCCGGCTGGACTACCGCCGGATGCTGGACGACGC
GACCGTACAGCGGTGGCCAGAGCTCGGCGAGACGCAGCAGCAGCAACAACAATCGCAGACACAGCAGCCACGACAGCCAA
ATCTCCCGCCAGCCGGCTACATGCCGGTGCAATTTGCCATGACGGACGAGGAGGTGCTGCAGGACGGGGTGCAGGAGGCA
GAGCGGCTGTTTGGGCCAAGCGGCACAACCGAGGCCGATGATATTGCGCTGGTTCGACGGCTGGTGCCGGCGGATGTGGG
CGAGCGGCTGGTCCGGCTGTACTGTCGCTGTGTACACCCGCGCTTCCCGGTGCTGGCCCTGGAGGATCTGGCGGCGATTC
AGGCGGTGGGCCGGCCGGATGACCCCCGAGAGAGCCGTGTTTCCGGGCAGCACGTTCCGGTTGGCCTGCTTAGTGCCGTC
TACGCGCTCGCGATGCCCTTCAGCTTCCTCGACGACGAGCTAAGCTTGCTCAAGGGCTACGTGCCCGTACCGACCGACGA
GCTCTGGGCCGTGACCCAGCGCAGCCACGCGCGCACGGCCGCGCTGTCGCACCTGTCGCTGCTGCAGCTCAGCTTGCTGC
TTCTGCAGCGTCCGCCCTACAACGACGCGGTGGCCTCGACGGCTGACATCTGGTCGCGCTCCTGCGCCGCCGTCGCCGTC
GCCGAGACCCTCGGCGTCAACTGCGACCCCTCCGCCTGGCGTCTGCCCCGCCGTGAGGCGGCCCTGCGCCGTCGTCTCTG
GTGGCTCACCTACGCTCAGCACGTCTGGCATGCCGTCGGTCTTGCCCGGCCCTGCCATCTACACGCCGACTGCTGGGATG
TCGCCGCCCCCGCGGCCGACGACTTGGCCGACGACCTCGCTTTTGCCCCCGACGACACCGTCCGCCAAATTGTCACCGCC
GAGATCCCTGTCCTTCTCGCCCACTGGCGTCTCAGCGTCATCGCAGCCGACGTGCTCAAAGAATTTTAGTAAGTCACGTG
CATTTGAACGGTGTTAGGCTGTATTCGCACTGTCCTTACATCTCCCTTCTCTCCTCTTCCCTCGCTCACCATTAGCACCT
TTCGCTCCGTCCGCGAGTCTGCCTCGCTCAGCGTCCTCCTCAGCCGCGCTCAGCCGCTTCGCTCGCGCATCGAGAGCTGG
AGACAGACCCTGCCGCTGCTGTCGCAGCCGGCTCTCCACCTCAGCGAGGACGACCTCGTCGTCGGTGCGTCGCTGCGTCT
CGCCCATTTGACCCTCGAGGTCCTCATCTTCCGCGCCCTGCTGCGTCCGCTGCTGCATGACGCCGTGCCTGTCGATGAGG
CCGGCGCAGTGGCCGAGCCCATGTCTACCATCTACGACAACTGCTACACCTGCGCCAAAGTCGGCATGGAGATTGTCGCC
TCCATGAAGGGCAAACACTTTGCCGTCTTCTGGCCGTGCTGTAGGTTCTCTCTCTCCCTCAGTTCTTTCGTCTCAACCAG
CTATCTTCTTTTCTCACACGCACAGACGTCCGCTACCAGCTCTGCTACATCTCCAGCTTCATCTTGCTGAGCCTGGCCCA
GTCGCCCACGAGAGACAATGCTGTGCGCAACCGCGATCTCCTCAACCGCTGGCGCGACACTCTGCGCATGCAGGCCCGTG
CCTGGCCGCTCGCTCGACTGGCCACCATTCGCCTCGACGCCATCTACTGGAAGGGCTTGCCGGCTGCTGTCTTGGGTGTC
GGCTCCGAGAGCCCAGCCGTGCAGCTACTACGCGAGAATGAAGCAAAGCATATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62