GenePrediction:GLEAN_5634 Details

Name: GLEAN_5634
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1932188..1930306 (- strand)
Length: 1883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1932188..1931893 (- strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_173:1931834..1931445 (- strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_173:1931374..1930306 (- strand)
Length: 1069
>GLEAN_5634 class=GenePrediction position=GCSC_173:1932188..1930306 (- strand)
ATGACGCTGACCAACGGCGCCTCCAAGCCGGCAACCGCCATCCAGGCGGAGTACGACGTCGTGATTGTGGGTGGCGGCCC
CGTCGGCCTGCTCATGGCCTACCAGCTGAAGCGGTTCGGCATCTCTGCCGCCGTGTTCGAGCAGCACGAGAAAGAGACCC
AGGACGCCTATGGTCGAGCAATTGCCTTTTTCCCCCGCACATTGGAGCAGCTGGACCAGTTGGAGCTGGTGGACCCCATG
CTGCAGCTCGGCTTTGCTTGCCGCAGTAGCGTGACATACAAGGACGGAAAGCAGATGTAAGTGGTCACGAGAAGCCTTGA
CGCCGCCCTCTACAAGAGCTAAGTGTCCGTCTAGCATTCCCGGTCGCGTCTGGACATTTATGGAGAACATGTCGGGCACG
GCTTTTGACTTTACCCTGGTGCTGCGACAGATGTACAGCGAGGAGATCCTGCGGACGAAGCTGGAGGAGATCAGCGCTCC
GTACTTTCAGGGCATTGAGTGCGCAGACTTTGTCATTGACGCCAGCGCGGCCGACAACGACTATGCCGTCACCACGTCGC
TGCTCAACCGCAAGACCAAGGAGACGCTGACGGTGAGGAGCAAGTACATCATCGGCACAGACGGAGGCCGCAGCTTTGTG
CGCCACCACGCCGGCATCCCCTTTGACGGCGACACGTCCGAGGACAAGTGGGTGCGCATCGACGGCATCATCGAGACGGA
CATGCCGATCACGCGGGCATACGGGTGAGTGCAGTCGCAGTCGGTGCAGTGTGTGTAGTGTAGTGCAGCAGTCCACCTTC
GCTGACACAGCCAGTGCCATCGAGAGCAAGACACACGGCAACGTGCTATGGGCGCCGCTGGACCACGGGGCCACGCGCAT
TGGCTATGCATACAGTGCCGCCATCGCGGCCAAGTACCCGGGCGGCATCACGCAGGAGATTGCCGAGAAGGAGGCGGCCG
AGAGCATGAAGCCGTTCCGGGTGACCTTCAAGGAGACGCACTGGTGGACGCTCTATGCGATCGGCCAGCGGATGGCCCGC
GAGTTCTCGACCAAGGCCGACCGCGTCTTCCTCTGCGGCGACGCTGCCCACACCCACAGCAGCGGTGCCGCCCAGGGCCT
TAACACGGGCACGCACGACGCTGTCAACCTGGCCTGGAAGCTAGCGCTACGTATCCGCGGCCTGTTGCAGCCGGCTGCCC
TGCACACGTACTCGGACGAGCGCAAGACAGTAGTCCAGCAGCTGATCAGCTACGACCGCGACATCGCCACCCTCATGTCC
CACAAGTGGCCCGAGTGGTATACTGGCGACCGCGATGCCGACCCTTACGTCATCCTCGGCGAGATCTTTGAGCGCGCCAC
CTCCTTCAACACCGGCCTCGGCATCTTCTACCCCCCCAACCTGCTGAACAAGAGCCACGACGGTGCCGCGCCCGCCGGCT
TGACCGTCCAGCCCGGCCATCGGCCCGCCGACGTGGCTCTCGCCATGCCCGGCACCGGCCAGGTCGTTCGCCTCCAGCAG
GCCACGCGCAATTGCGCCTGCTTCTGGGTCGTCGTGCTTGCCGGCCATGTCGCCTCCACCAAGCCCGCGCTCGAGGCCTT
CGCCGCCTTTTTGGCTGCCAACCCGGCCTTGACTGCCAACCCGGCCGTGCGCTTCCTCACAATCACACCCCCTGGCGTTG
GATCGCCGTTCGAGGTGCTCGGCGACATCAAGCCGTTTGGCACCACGTACTACGATCCCGAAGGTGCCGCACACCAGAAG
CTCGGCGTTCCATTGGACACAGGCGCCATTCTCATCGTGCGGCCAGACGGTCTTCTCGGCTCGGGCGGCCCCGTCAAGGG
CGAGTTTGTCAAGACATACTTTGCAGATGTTCTGACCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62