GenePrediction:GLEAN_5635 Details

Name: GLEAN_5635
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1919155..1917208 (- strand)
Length: 1948
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1919155..1919044 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_173:1918721..1918612 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_173:1917965..1917401 (- strand)
Length: 565
Type: CDS
Source: GLEAN
Position: GCSC_173:1917266..1917208 (- strand)
Length: 59
>GLEAN_5635 class=GenePrediction position=GCSC_173:1919155..1917208 (- strand)
ATGACGCCATCCGACTCGGAACCGACAAATTCGGCCCTGCTGCCCGGACCGGACAGCCTGCCTGCCCGTCGCATCCTGGC
CGTTGTCACGACCGGTGGCTTCACGCATGCAGGTAGCCGCTTCCTCGATCTCTTCCCCTGTTCTGTCTTGTACTGATCGG
ACAACCTCGCAGCCCTGTGCTTGAGGTGTGTCGACTGCTGGCCGCCCGCGGCCACACGGTCGAGTTTGCCACTCTGGGCG
GCTAGGAGTCATGGGCTCGCGACTGTCCATTTCTGTCGGCCGTGCACGTCGTTGGCCACTGCCCGATGGACGAGCAGACC
GAGGCACACTACAGCCGCATGCTTGGATGGGACCCTAGCCAAGGTCTTGGCCCTATTATGCAGTCCAAGTACCTTTGGGA
CTCGTTCTGGACGGCCGAGTACGCCGGCCTAAAGCGACTTGTCCGCCCCGATCTGCCAACCCGGCCCCCGACCTTATCCT
GGCCGACTTCTTTGCCGAGGCTGCTGCCAAGGACATGATGGTCCAGTTCGGCATCCCGGTCGCCGTTATGTGGCCGCAGA
TGCCTTTTCTAATAGCCCTGGTGCCTTACATCCCCGGTCAGCCGGGCTTCTAGGTCGACATAACCCTTACGTCCGAACAC
GCTTCTGTCTGGTCGCGGCTGCGCAACGAGATGGTTGTTGTTGTAGCCTTGCCCGCTATCCTTAAAATGGATGGCCTAGA
CTAAGCGGATGCGCCGTGCTGCTGGCGTTACTTGGTCTTTGCCCGCCGATCCTAAACCTGCCTACCTTGTCTTGGTTAAC
CCTTTCTTTAGCCTTAAGGTGCCTAAGGATCTGCCGCCCTTAATCGCCCCTGTTAGCCTTATCCTCGACAATGTCTATCC
ACCGCTATCGGCTCTCTTTTCCGATTTTTTTCGCGCGCACGATCGCACCCTCTACCTTGCTCTTAGCACCTACATTTTGC
TGCCTACTGCCGCCCTACACACTATCCTTTACAACCTTATTATTACCTTTAACGCTGGCTATATTAACGGCGTTATCTAG
TCTATCGGCTAGTCCCTGCGCGAAGCCTTTAATCCTACTGCCTCGTTCGTCCGCTTTAGCAAGCATAAAACGTCCTAAAT
TCTCTGCGTTAAGAGCCTTCTCGATGGAAAGCACGCCGACGAGTTCCTCCTCCCGCTGTTTGCGCCCTAGCGCGCCATCC
TTAACCACCCCCACTGCCGCCTCTATCTTACCCACGGCGGCGGGTCGTCGGCCAATGAGGCCTTCTTCCACGGAACGCCC
GTCCTTACGCTCGGGTTTTTCTTCGACCAGCTTTGTTATAGCGCCCGTCTGGCAGCCGCCGGCGTTGGTCTCCAGCTAAA
CAAGACCGACTTTAGTTCCCAGGAGATCTGCGACAAAGTCGGCCTGATTTTTAACGACGTCGTAGACGTGGACGGCAACT
CGCATAGTGCTATCACCCGCAATATGGAACGCATGAGGCTCATTGCCCGAGTCGCATCCCACAGGAAGCACCTCGCGGCC
GACCTTATTGAAGAGGTGCTTTACGACACAGAACTACGTGTTGATGTCAATGGCCACCAGCTGCGGCCTATGCACCTGCA
GATGGCCGACAGCCGCATGTCTGTCTGGCGGGCCAAAAATTGGGATCTCTGGTTACTAGGTGGCTGTGCCGTCGTTTTGC
CTCTAGGCCTTGTCTTTGCTATCGATGGTGTCCGCGCCAGAAAAGGTGACGTGCATTCCGGCCTAATGGCTACTTGTAAG
TAGGACTCTACATATTTTGTCCATCCTTTTTGTAGTGTAATGCAACCACTGGATTTGTGCCAGGATGCTCTCAAGCTGGT
GACGAGCGAGCTGCAACCATATTAGTCACTTGAACAATGACGCCGTCAGGCTTGGGAAGGAGCGACTCTGTCGGCATGAC
CCTGTTTGCCAGGAAACCTACGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62