GenePrediction:GLEAN_5636 Details

Name: GLEAN_5636
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1913901..1911957 (- strand)
Length: 1945
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1913901..1913800 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_173:1913729..1913644 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_173:1913578..1913319 (- strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_173:1913235..1913024 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_173:1912964..1912620 (- strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_173:1912562..1912470 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_173:1912405..1912165 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_173:1912111..1911957 (- strand)
Length: 155
>GLEAN_5636 class=GenePrediction position=GCSC_173:1913901..1911957 (- strand)
ATGGACAGTGACAGTGAAGCTCTGATTGAGCCTAATGGCTTGATCCCGTACGAAGAGGTCCAGAAGCACGTCACAGCAGA
TGACTGCTGGGTCATCATAGACGTCAGTGAGCTGCTGTTGCCGCTGCTGTCACAACCATAAAAACGTGCTGACACCTGAT
CCCACTCTCTAGGGTAATGTCTATGATGTGACATACTTCCTGAAGTCGCACCCGGGTGGCAAGCAGGCCATCCTCTTGCG
TGCCGGCAAAGACGTTACGTGAGTCGGAAGGACTGCCTGCTTTCTCTAATAAATCTGCTGACTTGTAACGACAATCGGCA
CAGAAAGCTCTTTTCGCAGATCCATCCGACCAACGCTCTGGCATCACTCCGCCCAGAGGCCTGCCTCGGCACCGTTAATC
CGGACACCCTTCCTGCGCTTGATGCAAAGGATGAAGAGGATGAGATTGAACGACAGGAAGCCCGCAACGAAATGCCACCC
CCTGAGGATCTGTTGTTGATAAAGGACTTTGAGGAATGGGCGGAGCGTGTGCTCAGCAAGACGGCTTGGTACTACTACCG
CAGTGCGGCAGATGAAGAGACGAGTAGGCAGTACTTCCACTTTGTCTTTCAGCCGTTCGGTTTCTCATGCCAGTCATCTT
TCTGACCAAGTGTCCACTCGATACAGCCTTCCACGAGAATAGAGACGCGTTCCGGCGGTACTTCTTCCGTCCGCGCATGC
TGCGTGACCTGACAAACGGAAGCGCCGAGACGACGTTTGTGGGTATTCCGACAGCTCTGCCCATTTTCATCTCTCCCGCC
GCCATGGCTAAGCTGGGCCACCCGCTCGGGGAGGTGAACATGACCCGCGCTGCGGCAGAGTGTGGCATTGTCCAGAGTGT
AAGAAGCACAACATCTAGACCAGTACAATAATATGCTGACTTGACCGACAATGGCAGATCTCGGCAAACGCAAGTTGCAG
CCTGGAGGAAATGTTTGCCGCCCGGGAGGACAGCCAGCCGTTGATCTACCAGGTGTACCTCAACAAGGACCGGACACAGT
CCGAGTCTATTCTCCGCAAGGTCGAACGCATGGGCGCCAAGGCAGTTATGTTCACAGTCGACACCGCCGGAGACTCGAAG
CGCACTCTTGACGAACGGCTCAAAGTTGCGGCGGCCGCCAAGTTACGTGAGGACAACGGCAAGACTACCAAGTCTGAACC
ACTAGAACCATTAGCCATCGGCCACGCCATCTCAGGATACCAAGACCGCAATCTGACGTGGAAGGACATTGGCTTTATCA
GAGTGAGTCGAGGGTGTATTTGTTGGGATGCAGCCGCAGCTGACTAATACACATTCTAGAAAAATACGAAACTGCCCATC
ATCGTGAAGGGTATCCAGTCAGTGGAAGACGTTCAGCTCTGTGTAGACCACGGTGTGGAAGGCGTTATCCTAGTAAGCTA
GCACCAAGGCTGAAGAAGAAGGAAAGAATCAATCACCTGACCTACATCTCTCGTAGTCGAACCACGGCGGTCGCCAGGCA
GATTATGCGCCGGCACCCATCGACGTTCTTTACGAGATACGGGTACTCCGGCCGGACCTGTTTGACAAGATCGACATTAT
GATTGATGGCGGTGTACGGACGGGTGCCGATGTGGTAAAGGCAGTTGCACTGGGTGCCAAGGCCGTCGGCTTGGGCCGGC
CGTTCCTGTATGCCAACGGGACTCACGGCCAAGAAGGCGTGCGGCGCGTGATAGAAAGTGAGTGCCGATGGTGACAGGGG
ATGCAAGAGGAGTAGCCGCTGACATGACAGTTCTCCACGAGGAGATTGTAAACACGATGCGCAACATTGGTGCGGCGACA
ATTAAGGACCTGAAGCCCGATATGGTAGGCCCAGCAGGGCCTTGGGTTGGACACAACCGACCGATGTATGTCTCTTCTGG
GGGCATCGATCAACGGAAGATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62