GenePrediction:GLEAN_5638 Details

Name: GLEAN_5638
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1889794..1887926 (- strand)
Length: 1869
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1889794..1889574 (- strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_173:1889508..1888547 (- strand)
Length: 962
Type: CDS
Source: GLEAN
Position: GCSC_173:1888483..1888247 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_173:1888194..1887926 (- strand)
Length: 269
>GLEAN_5638 class=GenePrediction position=GCSC_173:1889794..1887926 (- strand)
ATGGGTTCCACCAATAAGACAGACCGGACGGACGTGGGCCACTCTCATCTGTCCCCTATCTTTGCCCCCAAGCGCACGCT
TTCCGTTATTGTGATCGGGGCTGGTGCGTCGGGCTTGCTTCTCGCCTACAAGCTACAGCGCCACTTTGACGATCTGTCGC
TAGAGGTGTATGAAAAGAACGCAGACGTCTCGGGAACGTGGTATGAGAACAGATACCCAGGGTGCGTACACAGATTCCAG
TGCTCGGTGTTTTCTTCTTACGACGTACTAACAAGTACGTCATCAGATGCGCGTGTGATGTCCCAAGCCACAACTACACC
TGGAGCTTTGAGCCAAAGACAGACTGGAGCGCAAACTATGCCGCATCCAAGGAGATTTTTGCGTATTTCAAGGACTTCAG
CGCCAAGCACGGCCTGGAAAAGTATGTAAGATTGCGGCACCAAGTCGTCGGGGCGCGTTGGGACGACGATGAGGCGATGT
GGCACGTGCAGATTGACGACCTGGCACACGGCACTCGGGTCGAGAGGACTGCGCAGATCTTGATCAACGCCGGCGGAATA
TTGAACGCGTGGCGCTTTCCCCCAATTCCGGGCATCCAAACCTTCAAAGGGCCGCTCGTGCATTCGGCAGCGTGGCCCGA
GGAGGAGCTTGACCTAGAGGGCAAAACCGTTGGGCTGATCGGCAACGGATCGTCAGGAATCCAGATTTTGCCTGCCATCA
AGGATAAGGTGGGCAGCCTGGTGACATTTGTACGCGAGGCAACCTGGGTGGCACCACCTCTAGGCGGGGAATTTCATGCC
TACACGGACGAAGACCGACAGCGCTTTTCTACGGACAAGGACTCTCACCTGGCCATGCGTAAGGAGACCGAGAAGTCGGC
CAACAGCATGTTTGCCATCTTCCACAGCGGATCACAGCACCAGGCCGGGTTGCGGATGTACATGGAGGATCTGATGCGCA
AGAAGCTTGCCAACCCGGAGCTAGAAAACGTCCTGATCCCAGAGTGGTCGGTGGGTTGTCGCCGTCTAACGCCAGGCACA
AACTACCTTGAGAGTCTGGGGGACCGAAATGTGCAGACGGTGTATGGTGAAATCACACAGATCACGCCGACCGGCGTAGT
TTGTGACGATGGCAAGGGAGAGTATTCAATCGATGTGCTCGTCTGCGCAACCGGATTTGATACGACATTCAAGCCGCGCT
TTTCTCTGGAAGGTACCCAGGGTGCGAAGCTAGAGGAAATGTGGAAGGGTAGGCTCTCTCGGCGGCGGCATGTAGTATCC
TATCTGTACAGGAATGGACTAACGAGATCAGATGAGCCTCAGGCATATCTAGGCATGTCCGTCGACAGGTTTCCCAACTA
TCTCTTCACGTTGGGACCCAACTGTCCGATAGGAAATGGCCCCGTGCTCATTAGCATTGAAGCCGAGGTCGAGTACATTG
TCAAGATGCTGTCCAAATTCCAAAAGGAAAATCTTCGCTCATTTGAGGTCAAGAGAGAGGCGGTACGCGACTTTAACGAA
TGGAAGGATGTATGGATGAAAGAATCTAGTACGTGTCCTGTTTTCCCTCCCTGGTTTCGTGCTAGTACTGATGATAGCAG
TCTGGGCAGAGGCGTGCCGATCCTGGTACAAAGCTGGTTCGGCCTCAGGCAAGATTCTGGCCCTGTGGCCCGGCTCGACG
CTGCACTATCTCGAGGCCATCCATGAGCCCCGTTGGGAGGATTGGGAGTTTAAACAGGCAGCTGGCGGGAATCGGTTCGG
GTTTCTGGGAAATGGACACAGCACAGCCGAAGCATTTGGGGGTGACTTGAGCTACTACATCCGCGATCGCGATGATTCGC
CGGTTGACCCTGTTTTGAAACGCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62