GenePrediction:GLEAN_563 Details

Name: GLEAN_563
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:626705..628716 (+ strand)
Length: 2012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:626705..627147 (+ strand)
Length: 443
Type: CDS
Source: GLEAN
Position: GCSC_97:627214..627372 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_97:627438..628716 (+ strand)
Length: 1279
>GLEAN_563 class=GenePrediction position=GCSC_97:626705..628716 (+ strand)
ATGGTCCTCAACAGAGTTGACGACGAGATGGCCGAGATCGAGGAGGACGCGTCTCCGACCGTCTTTCCCACGCGCATCTC
CCGGGCCAGCTTGGAGCGCCGCAACAGCCTCGACGCTACGCTCGCCCACATACCCACGGCCTCGTCCTCGTCCTCGTCGG
AAGATGCTGCCAGCGCGCGCCACCGCCACGCTTCGGGCGAACCGGGCCCGTCTGGCCTTAACCGCACCCTCTCCATCGTC
GACCTCGAGCGGATTCAGACGGCCAAAAGCCAGCGCAGCGGCACCGTCGGCCGCTCGCACACTGGCAGCCGCTCGCACAA
GCCGCTGCCGGCCTTTGGTGCCGGCAAGCCCTACCCGCCGCAAATGGACCAGGAGAAGTACGTGGTCGAGTTCGACGGCC
CGGACGACCCGTTGCACGCCCAGAACTGGCCTCTGAAGAAGAAGTACGTTCCCTCTCCTCTCCTCTCGGACTCGGCATTG
TCCTCCCAAAACTAACTACAACCGTCCAGGTTGTACACCGCTGCCATCCTCGGCTTCACCACCATGACGGCCGCCTTCAC
ATCCAGCATCTTCTCCGCCGCAACGTCCCATGTGGCTGCCGAGTACCACGTGTCCGCAGAGGTTGGCACGCTCGGTGTGT
CCTTTTACGTCATGGGCTTCGCCTTTGGGTATGTCTTCTCGGCCCGCTTGCCGTGCACACGTTGCCTTGCTGACCTTTGC
CTCTCTTGTCCAGTCCGACTCTGTGGGCCCCGCTGTCCGAGCTCAAGGGCCGTGTTATGCCGCTCGCCATCTCCATGTTT
GGCTTTTCCGTCTTCTGTATCGCCGTCGCCACCGCCAAGGATCTGCAGACGGTGCTGATCTGCCGTTTCTTTGGTGGCTT
TTTTGGCGCTTGTCCACTGGCCGTCGTCGCCGCCGTCTTCTCCGACATGTTTGGCAATCAGACGCGCGGCATCGCCATCA
CCATCTTCTCCATGGCTGTCTTCTCGGGCCCGCTGCTGGCGCCCTTTATCGGCGGCTTCATCTCAACGTCGTACCTCGGC
TGGCGCTGGACCCAGTACATCCCGGCCTTTATGGGCTTCTTCTGCTTCGCCCTCATCGTGCTCTTCCAGGAGGAGACGTA
CCCGCCGGCCATCCTGGTCCAGAAGGCCTCGAACCTGCGCCGCGCCACGCTCAACTGGGGCATCCACGCTCGCCAGGACG
AGATTGAGGTTGACCTGAAGGAGCTGATCACCAAGAACTTCTCGCGTCCCATGCGCCTGCTCTTCCTCGAGCCCATCGTC
ACGTCGCTGTCGGTCTATATGGCCTTTGTGTACGGCATCCTGTACCTCTTCCTGACGGCCTACCCGTTTGTCTTCCAAAA
GGTCCACCACATGACACCCGGTGTTGGCGGGCTGCCTTTCTTCGGCATGATCATCGGCCAGTTGCTGTCCGGGCTCAGCG
TGCTCCTGCAGCAGCCGTGGTACAACCGCAAGCTGGCGGCCAACAACAACGTGCCCATTCCCGAGTGGCGCCTGCCGTCC
GTCATCGCCGGTGGCGTCTCCTTCACCTGCGGCATCTTCTGGTTCGGCTGGTCGGGCTACAAGGAGAGCGTGCACTGGAT
CGTCCCGACGCTCTCTGGCCTCATGACCGGCTTTGGGCTCATGTCCATCTTCCTGCAGTCGCTCAACTACCTTGTCGATG
CCTACCTCATGTTTGCTGCCTCAGCCATTGCTGGCAACACCTTTTTGCGGTCGCTCTGTGGCGCCGGCTTCCCCCTGTTC
GCCACGTACATGTTCAACGGCATGGGCATCGAGTGGGCCAGCACGCTGCTCGGCTGTGTCGGCGGCGCCCTGGTGCCCAT
CCCCGTCATCTTCTACATCTATGGCGAGAAGATTCGGGGCATGAGCAGCTATGCTCCTGGCGGTCAGGCCGGCAAGAGCT
CTGACGAGGACGAGCCGGAGCCGGTTGGTGTTAGCCGGGCCGTGGCCAACGGTGATATCGAGGCCGGAGCAGTCAACAGG
AAGGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62