GenePrediction:GLEAN_5640 Details

Name: GLEAN_5640
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1880971..1879463 (- strand)
Length: 1509
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1880971..1879951 (- strand)
Length: 1021
Type: CDS
Source: GLEAN
Position: GCSC_173:1879897..1879754 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_173:1879701..1879463 (- strand)
Length: 239
>GLEAN_5640 class=GenePrediction position=GCSC_173:1880971..1879463 (- strand)
ATGGCGATCTCTGAGGAAGCAAAGTCACTGGCGGCATTTGAGCCGTCCGCCTTTGGCGCAATCCATGCAGAGTTGCAGGC
GACTTTCAGCTCGGGCAAGACCAAGGCGATTGCCTGGCGGAAGTGGCAGCTCAAGCAGTTCTGGTGGATGGTCGAGGACA
ACGAGCAGGCCATACTGGATGCTCTGGCGGCCGACCTGGGACGCCACGAGATGGAAGGTCGGGCGGCCGACCTGTTGGGT
CTCAAGAGCGACATCCTCGAGCACCTCGGGCATGTGGACGAGTGGGCGGCGACGACGCGTGTGGCCGACGCGGGCCTGCT
CTTTGGCGGCCTCGGGCGTGCACGTCTGCGCAAAGAGCCGGTCGGTGTGGTCCTCGTGATCGGGGCATGGAACTTTCCCT
TTTTGCTGACGCTGCAGCCGGTGATAGCAGCCATTGCAGCCGGCTGTTGCGTCGTGATGAAGCCGTCCGAGCTGGCGCCG
GCATCAGAGCGCGTCATGGCCGACCTGGTGCACCGCTACCTCGACCGATCGGCTGTGCGGCTGGTCCGAGGAGGCCCTGA
AGAGACTACTGCCGTCCTGCAGCGGCGGTTCGACCACATCTTCTTTACTGGCTCGTCCACGATCGCCCGCTTCGTCACCG
CCGCTGCTGCTCGACACCTCACGCCCACGACGCTCGAGCTTGGCGGCCAGTGTCCGGCCATCGTTGCCCAGACGGCCGAC
GTCGATCTCGCTGCCCGGCGCATCGCCTACGCCAAGTTCCTCAACGCCGGCCAGATCTGCCTCTCGGTCAACCACGTGCT
CGTGCACCCGGCCGTCCATCACGCCTTTCTCGCCCGCCTCGAGCACTGGACCCGCACGTTCGCCGCCTCTGGCCACATGT
GCCGCATCATCTCAGACCGACACTACGACCGGCTCGCGCGCATCCTCGACAGCACGCAGGGAACGGTCATCCGCACGGCC
GAAAGCTCGAGAGAAGAGCGAAGACTGGCGTCTGCCATCGTCTCCAACGTGACCATGTCTGGTGTGCACATTCGCCACCT
CTGCCGGAACTCCTGCTTGCTAACACAATCACAGATCCGGTCATGAGCGAAGAACTGTTTGGCCCTATATGCCCCGTGTT
GAAGACCGATACCGTAGATGCGATTGCCGCCGTCAATAGCCTTCCACGACCTCTGGGCCTGTATATTTTCAGCGCGGACA
AGGCGGAAATCGAGACAAGTAAGGTGACCGGGAGATCACAGACGTCCACTTGCACTAACACCGAGAAAAGTCCAGAACCA
GACGCTTTCCGGTGGTCGACCATCAACGATGCCACTATGCACGCCGGATGTCCAGGGGCTCCCTTTGGCGGTGTTGGGGA
ATCTGGAATGGGCTATTACCATGGCAAGTACGGCTTTCTGGCCTTTACACACCTACGTACCGTGGTTGAGCTGCCTACCT
ATCTGGACAGGGTCCTGTCGTTTCGTTATCCGCCCTACAACACACGCAACAAGAGCTATGTTGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62