GenePrediction:GLEAN_5641 Details

Name: GLEAN_5641
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1874820..1872722 (- strand)
Length: 2099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1874820..1874682 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_173:1874629..1874135 (- strand)
Length: 495
Type: CDS
Source: GLEAN
Position: GCSC_173:1874084..1873891 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_173:1873823..1873750 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_173:1873682..1872838 (- strand)
Length: 845
Type: CDS
Source: GLEAN
Position: GCSC_173:1872774..1872722 (- strand)
Length: 53
>GLEAN_5641 class=GenePrediction position=GCSC_173:1874820..1872722 (- strand)
ATGGCCACAGAACAGCGCCCTGTAACGATTGCTAACACTAGCGGAGCCACAGGAGATGGACCCCTTGCACTTCGCCGTGT
CGTCCGAGAAGGACCGGTCGATGTCGTGACGGCCGATTACCTGGCCGAGGTCAATATTGGTCAGTAGGTTTTTTTATGCA
GTGGCACGTGACTTTAATAACCGAGGAGCAGCCTGGCTTGCCCTAGAAAAAAAGCAGGACCCGAACAAGGGCTACGAGAA
AAGTTTCCTCCGGCAGCTAGATCGAGACACAGCCCATATCGTTGCGGAGAAGGGCATCAAGATCATCCACAATGGCGGGG
CACTCAACCCCAAAGGTCTCGCCCACGAGGTTGAGAAGCTTCTGCAGTCGTATGACATCACGACGCTGAAAATAGCCTAC
GTCGAGGGTGACAATGTTATCGGGAAGCTGGAGACCCTTCAAAAGCCGGGCTATGCTCCCCATCTGGACGTCCAAGGCCG
CGATCTCTCTCATGTCGAAAAGCCGGTCCTCAGCGCGAACGCTTACGTGGGAATGGGCGGCATTGTTGCTGCCCTCAAGA
TGGGCGCAGATATCATCATCTCAGGCCGCTGTTGTGACGCCAGTCCCGTCATGGCTGCTGCAGCCTGGTGGCGTGGCTGG
AAAGAGACGGACTATGATAGGCTGTCTGGGGCGCTGCTTGCAGGCCGTAAGTTACCCTTCCATCAGCAACTAGCATTTGT
GTATGCTGACCTGCAGACTGCATCGAATGCGGTTGCTATGCTACCGGGGGCAACTTTTCCGGCTTCAAGTCCATCCCGCA
TAACTGGAACCAGGGCTTTCCCATTGCCGATATTGCCGCTGACGGCACGTTTGATATCTCTCTCCAAGAAGGTGCCCATG
GTCTCGTCAGCAGAGACACTATCACAGCCCAGCTTGTGTATGAGATTCAGGTAGCCAATCTTGCAAAAAAAAATAAGGTT
CAAATTCTGGAGAGCAATTTCTCACATCAATTGATAGGGCCCGTTTTACCTCAACCCGGATGTAGTCGCAGACATTCGTG
ATGTCCAAATTCACCCCAAGGGGAAAAATAGGTCCGACAATCCACTCTACACTCCCCGTCTTTTCTTTTTATATGCGTAC
TAACCGGTTACCCCAAAGAGTCTCCGTCTCGGGCATCCATGGCACGCCACCACCGCCCACCACCAAACTGGCCATCTGCA
CCAGTTCCGGCTTCCAGCTAGAGTACTACATGTTTGCCGCAGGCCTGGATATTGCGGAGAAGCTCTCTGACCTCCGATCG
GTTCTTGACGAGGTCGTGCCCAATCGCAAAGACTACACCGTCCTCCGAGTCGACCAGTACGGCACGCCGCAGCCAAATGC
GTCTAGCCAGGCCCTGGCGACCTGCATGTTCCGCATTTTTGCCCAGGCAGAGAAGGTAGAGACCCTCAGCACGCTCCGGC
AGGCTATTGGAGGCTACGGTCTCGGCGGCTTCTGTGGCCAGCACGGCTGCATGGACTTCCGCATGCTGACACCGCGGCCT
TTTGTGAGCTACGAGCCGTTCCGCGTTCCTTACTCTGATGCCGAGATACGGGTGACCATGGGCAGTCGCACAGAGTCGGT
CACCGTGCCACACAAGACACAGATCTTTGGTGGACAGGTCAGCTACGACTCACAAGACAATTATGCTCGGGCTTCATTTG
GCACCACTGTTCCCGCGCCCTTGGGCTCCAGAGTTCATGCACGATCCGGCGACAAGGGCTCTAATGCTAATGTGGGATTC
TGGGTTCTGCAAGACGACGAGTACGCTTGGCTTCGATCGTTTCTCTCTATTGAGCGACTCAAGAATCTGCTTGGCGACGA
CTATCATGAAAGCTACACGATTGAACGCTTCGAGATCCCCCACCTCCGTTGTGTCCATTTTCTGGTAATCGGGGTGCTGG
AAGGCGGTATCAGCTCTTCGTACAAGCTCGACGGGTTGGCTAAAAGCTTTGGCGAGTTCCTCCGTACGTAAACCTACATC
CTCCTGCATGACATGGCAGAGTTTCACTGACTCAAGTTGAATATAGGGTTCAGAGAGGTGGACATGCCGAAGAGTTTTCT
CAATAGGGGACGGCTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62