GenePrediction:GLEAN_5642 Details

Name: GLEAN_5642
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1870053..1868904 (- strand)
Length: 1150
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1870053..1870039 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_173:1869942..1869165 (- strand)
Length: 778
Type: CDS
Source: GLEAN
Position: GCSC_173:1869106..1868904 (- strand)
Length: 203
>GLEAN_5642 class=GenePrediction position=GCSC_173:1870053..1868904 (- strand)
ATGACGGACGAAGACGTCACACAGCGGCAGAAGCTGATGAAGGCTGCTATGATACTCGAGGCAAGACGGCTCCTGCACCC
CTGATCATCTCCATATTGACGTCTGCTGCAGTACAACTCCCCGTACACAATCGTGGACAACATCCCGGTGCCTGATCCGG
GCCCGAACCAGATTCTTGTCCGCATCACGGCCTCGTCGCTCTGCATGAGCGATGTCATGGGCATCCGAGGCTACACGAAC
AGCCCATTGCCTTACTGCGGAGGCCACGAGCCAGTGGGCCTGGTAGAGCAGGTCGGCCCTGGCGTCTGTGGCTTCAAGTC
TGGCGACCGCGTCGGCTTCATGCCGGCATCCCGCACATGTCAGGACTGTGCAGCCTGCCTCTCGGGCAACCACCGGTACT
GTGCCGAAAAGGTGTCGGTTGGTTTCAGCGGACGCTACGGCGGGTTCTCGCAGTACTGCCTCTCGGATCCTCTGTCCACG
GTCAAGGTCCCAGACGGCCTCTCGGACCAGGACGCAGCACCCTTATTCTGCGCCGGCGTCACCGCGTACGGTGCCGTAAA
GAAGGCTGCCCGCAGACAGGTCGGCGGGTCCCTGGTCAACATTGTCGGCTCCGGCGGCGTGGGCCATCTGGCTATTATGT
ATGCCAAAGCCATGGGCTTCCGTGTGCATGCCTTTGATGTAGCTGCGGACAAGCTCGACCTGGCGCTGCAGTCGGGAGCC
GATGCGGCCTTCAACTCGGCTACTACAGACCTGGCAAACGTCGAGAAGGCTGCATCAACGATTGTCATCAGTGGTGCCAT
CAAGGCTTATAGCTTTGCCATGAAGATCACCAACACGTGTGGTGCCGTGATTGCCGTTGGTGCGCCTCACGAGCCGTTCC
CTTGCAATGGTACGGGACACCTCTTCTTATCTTCGTCTTCATAAACACTAATCAGAACAACTTGCAGTCACCGAGATGGT
CTTGAGCGAACTCTCTCTCATTGCGACAAACCAAGGTACAAAGCAGGAACTCTCGGAAGCTGTGGCACTCGCTGCAGAGA
AGGGAATCAAACCCGTCACCCAGACATGGCATATCGACGACATCAACGCGGCCATGGATGATATGCTGGCTGGAAAGGTG
GCCGGAAGGATTGTATTTCGGATGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62