GenePrediction:GLEAN_5643 Details

Name: GLEAN_5643
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1866871..1865026 (- strand)
Length: 1846
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1866871..1866268 (- strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_173:1866191..1865026 (- strand)
Length: 1166
>GLEAN_5643 class=GenePrediction position=GCSC_173:1866871..1865026 (- strand)
ATGTCAGGACATAAGGACGGTGTGAATCGGGATGCCATTGGCTCAGCAGACGACAACATGAAGGAACAAACCAGGCCCGA
GGCTGAAGAGGTGGAAAAAGCTGGTGCTGTAGATGGCAGCAGCTCCGAGACAGAGGACTCCGAGAACGAAGACTTTCGGA
TGACCTGGGCCAAGGGACTAGCCATGGCCTCGTTCCAGCTCGGCTATCTGTCCGATGTCTTTGTCCTGACCATGGCTTCC
ACGTTGCTGCAACAGATCAACCAGGACATTGGCCCCAGCAACGACTATGCGTGGATGGCCACGGCCCAAGTTCTCGGTGC
GGCCGTCATGTCGCCGTCAGTCGGTCGGCTGAGCGATATCTTTGGTCGTCGGAACTTTCTCCTCGCCGGCAGCGTGGTCG
CTGCCGTTGGCTGTGCCGTTGCAGCCACAGCCAAGCAGGTCAACACGGTCATCGGTGCCGGCGCCATCATCGGCGTCGGC
AGCGCTATGCACCAGCTGGCATGGTCCTGCCTTGCCGAGCTCGTGCCCAAGAAGACCCGATTTCTCGCCCTCGGCATCTT
CCAGGCCACGTTGGCCCCATCTTCGGCTTTCGCGCCCGTCATCGGTAAGACACGTCTGACTTTCTGTGCATTCTTCCTTG
TTGCGTCCTGCAAGATGGAACACTGACCATCTTCTGGCAGCATACAGCTTCGTGGTGCATACAAAAGCCACCTGGCGTGG
TGCATACTGGCTGCCCTTTTCTCTTGACGTTGCTGCCCTCGTGCTCGTCTTCATCTTCTACCGGCCGCAGAATCAATACA
TTCGCGTCCAGGGAAAGACCCAGCTGCAGCAGCTTCTGGGCCTCGACTGGGTCGGAAACTTCCTCCTCGTCTCCGGACTC
GTGCTTCTTCTCATGGGCATCTCACTCGGCGGCTCGCGGTTTCCTTGGAAGTCGGCCGGAACCATTGCGCCTATCGTCAT
CGGCTTCATCTTGCTCATCGCTCTCGGTCTGTGGGAGACTTACGCTTCGCTAGAGTCGCCCATCTTCCCTCGCGCCGTCT
TTTCCAACGTCCGCGGTTTCACCGTCATCATCATCGGCGTCTTTCTCATCGGAATGCTATACTATTCCACCGCAGTGCTA
TGGCCCCAGCAGATCATCTTCCTGTACACGGAGAACCTAATCACCTCCGGCTGGTATGCCTCGGCCATGGGCCTGGCAGG
CTGTGTTGTCGGGCCGCTTGCAGGCTGGGCCTTTGCTAGAATAGGACATTCCCGACTGGTTCTCACGGCCACGATTGCTG
TTTTGGCCGTCTGCTCTGGCGCACAGGCTATTGTCAGTCCCACATCAAACGTAGCATCCACGGTTCTTGTCGCCCTCGTT
GGTATAGCCGTAGCTTCTGCTACCATTGCAACAACTACAATGATCCAAGTGGGCGTCTCTCATGAGTACATTGGCATTGC
CACGGGTCTCGCCATCACCGCACGTAGCGTTGGTGGCTCAGTCGCCACGACAATCTATTCAACCGTCCTCAAGTCCCGTT
TCACCACCAATCTCATCGATGACGCAGCGACTCCCTTGATACAGGCGGGTGTTGCGCCTTTATCTGTTGGTGGTATTATT
GAGGCTTTGCTAGGAGGCTCGCCGGAAGCGCTTGTGGGCCTCTCGCCTGACATTATCGCCGTTGCCGAGACGGGAATCAA
AAAGGCATTTGCACATGCTCTGCGAACTGTATACCTTGTTAGCATTGCGTTTGGGGTGGTTGGCGTTATTTGCGTGGCCT
TTAGCGAAGATGTGAGCCATCTCATGACCAACGAAGTGGATGTTCGGCTTACGACAGAGCAACATAAAACACACAGCAAG
GTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62