GenePrediction:GLEAN_5644 Details

Name: GLEAN_5644
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1857109..1856638 (- strand)
Length: 472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1857109..1857000 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_173:1856938..1856638 (- strand)
Length: 301
>GLEAN_5644 class=GenePrediction position=GCSC_173:1857109..1856638 (- strand)
ATGAAGTTCATCGCCGCCGCCCTTTTCTCTGCTGCCGTTGTCTCGGCCGACGCAATCTACAGCGTCACGGACTTCAACGC
CGGATGCATCCCCCACAGCGTTGAGTGCAGGTAAGCAGCCTTACAGGAAGGCTTGATTGATTCCTATTCTCTAAGCTAAT
CTCTTTCACAGCTACTCCTTCAGCGTGGTCCATGTCAACAACGGCGAGTTTGTGCCGGTCAACTGCACGGCCTCGGCCGT
CTCCGACAACACTCTGCCGGCGGTCACGGGCACCTGTGAAGAGTCTTCCCGCACCTTTGTCATCGCCCGCAACAGCACCG
GCTTGACCCTGACCGTGACGCAGCCGGTTTCCGTGGTCAGCTACGAGAGTGGCTCCCACTTCATCCCCAAGGATGAGATT
ACCACGAAGAGTGACCAGGTCGCCACGCTCGAGATTTACGATGGCCCGACTGCCTTCACCCTGTTCGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62