GenePrediction:GLEAN_5645 Details

Name: GLEAN_5645
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1848566..1846627 (- strand)
Length: 1940
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1848566..1848223 (- strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_173:1848153..1847895 (- strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_173:1847841..1846627 (- strand)
Length: 1215
>GLEAN_5645 class=GenePrediction position=GCSC_173:1848566..1846627 (- strand)
ATGGACACGTTCAGTTGGAACAAAATAAATGTCTCGGTCAAGGACCGCACGACCAAGACACCCCTCTCCCTCCTCTCTAA
TGTGGCTGGTCTGGTGCGCGCGGGAGAAATGCTGGCCATCATGGGGCCCAGCGGCTCCGGAAAGACGACCCTGCTAAACG
CTCTGGCCCACCGAGTGGCTGCCGCTGGCGCTACTACCACGGGCGAGATATGCGCAAACGGACAGCAGGTGACGCGCAGC
AGTATTCGCGCCTTGTCGTCGTATGTCGAGCAGGAGGATGCCTTGATTGGAAGCTTGACCGTTCGTGAGACGATGATGTT
TGCCGCACAGCTCTCACTACCAAGGTAGGAAGATAGACAAACTACGACCAAACCCAAGGCATGATGGAAGGAGCCACTAA
TTCATTCGTCTAGAAATGTCAGCAGGAAGGAGGCCTTTCACCGGGTGGACGACCTGATCGCTAGTTTTGGTCTTCAGTTG
CAGGCCAATACCATTGTAGGCACTCCTTGGAGCAAAGGTCTGAGCGGTGGCCAGAAGAAACGTCTCAGTGTGGCCAGCCG
TCTTGTTACCAACCCAAAGATTATGTTTCTCGACGAGCCTACAAGCGGCCTCGACTCTGCCCTCAGCCGAGAGGTGTGCA
GCTACATCAAGGCCATTGGAAAGGCCAATAACGTGAGTTAAGCGTGCGTTCACGCGAGCTTCTTCTGGTACTGACCCTTT
TGCAGCTCATCATCATTGCCTCTATCCACCAGCCGTCCTCGACCACATACCATCAATTTGACAAACTCTGCTTGCTATCC
GGTGGCCGAACGTGCTATTTTGGTGGGACTGCAGAAGCGCCTGCGTATTTCTCGCGCATCGGCTATCCAGTTCCGTTGGA
CTCTAGCTCTCCAGAGCACTTCCTCGACCTCGTGAACACTGACATCGACACAACCGGAGAGATTCGGCGCCGCACAGATG
GCATCTCACGTGCCTGGAACACGTCCGATCTCGCTGCCGGTCTGCAGATGGACGTTGACCACAGGGACAACGACGGTCAG
AGTAGCCCTGTTCTCGACAACTACAAGGCAGACGGACCAAGACCGTGGGTGGTGCCGGTTGTGTTGCTGCACCGCTCATG
GATCAAATCGTATCGCGACGTCATGGCCTACGGAATTCGCTTGGCCATGTACCTGGGTCTGGCCATACTGATGGGTACCG
TCTTCCTACGTCTCCAGCCAGAACAAAAGTACATTCAGCCTTACACCAATGCCATATTCTTTGGCGGGGCCTTTATGTCA
TTCATGGCGGTCGCTTACGTTCCGGCCTTTCTTGAGGACCTTGGCACTTTCAAGCAGGAGCGTGCCAACGGTCTTGTCAC
GCCCTTGTCCTTCTTGGTGCCCAATTTTCTAATTGGCTTGCCCTTCCTCTTCTTCTTCGCACTGGTCTTCTCAATCATCG
TTTACTGGCTTTCCAACTTTACTCCGAGCGGCTCTGCCTTTTTCAGATGGGTTCTCTGGCTTTTCCTCGACCTGATTGCT
GCCGAGTCGCTGGTGGTTCTCGTATCGTCTATTTTCAACGTTTTTGTTCTGGCACTAGCCGTCACGGCTTTTGCCAACGG
TCTTTGGATGTGTGTGGACGGATTCCTGGTGCCCATGTCAATACTGAATGTGTTTTGGAAATACGTCTTCCACTATATCG
ACTACCAAGCCTACGTTTTCCAGGGCATGATGGTCAATGAGTTTGAACACCGCGAGTACTGGTGTGCAAAGACAGATGGC
GGCCTGTATCAGTGCAGCTACTCTAGTGATCTCAATAACGTCGGAAAGATTCGAGGCACCGACGTCCTGAAAGAACTCAG
CATCCACACGGGACAGGAGGGCACTTGGATTGGTATCATGATTGGAATCATTGCGGGCTATCGGCTGTTGGCCTATCTAG
TCCTGGTGATGCGCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62