GenePrediction:GLEAN_5646 Details

Name: GLEAN_5646
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1843735..1842555 (- strand)
Length: 1181
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1843735..1842728 (- strand)
Length: 1008
Type: CDS
Source: GLEAN
Position: GCSC_173:1842668..1842555 (- strand)
Length: 114
>GLEAN_5646 class=GenePrediction position=GCSC_173:1843735..1842555 (- strand)
ATGCGCTACCAGCCGTTCTTTTCTGCCGTTCTTGTGAGCGGCCTCACGTCAGCCACTACAACTTCTCTCCCGTCTCTGTA
CGATGCTCTCGTGGCAGCCGGTGCTTCCAACTTTGCCGCTCGCATCCAGGCAAGTCCCAATGCGTCAGAGCTGTATAGCT
CTGGTGCTATCAAGACTGTGTTCGCTCCGTCCGACCAGGCCATTGGCTCCTCGAGCTTGGCCCGGCGGGCTGACGTTAGT
GAAGGAACGCTGGTGTACCAGAGCTGTCTGGTAGAAACGTATCTACAGCAAAAGACCTTGGGCGCCCAGGGTGGTGAAGT
GTTGGCCATGGGATACAAATCGTCTGGTTTGGTAGACACGTCGCAAAAAATAGTAGCAGATACGCGACCTGTTAATACCA
CCGTGTCCAAGCGGCAAGTCTTGGGAGTCCGAGGGCCGTACCGACGCTCTGCCAATGCCACATCGCTGCTGAGAATTGAG
TCTGGTCTGGGGACTGTGTCCAATGTCATTCGGGGAGACATTGCCTTTGACGGCGGGCTTATACAAGTCACCGATAGGTA
CGATTCCATTGTTGAAAACAAGGAATTCAAAAAAGAATACAATGCCGAGGAAGCTCACTCACATTGTTTCAGCTATTTCA
CTCTCCCCGAGTCGCTTTCGTCCACGGCTGCTCAGACGGGCCAAACAACATTCAATAGCCTTTCCAACAAGACCAATATC
ACAAGAAGTCTCGAGCAGACGCAGTCCATCACTGTGTTTCTGCCCTCCAATGAGGCCTTTGCCTTGGCTGGAAACAGAAC
TACGAGCACGTCCACTCTGATCTCAAATCATGCTGTCAGCGGCTTTGTCGGCTACCTTCCAGACCTCACCGACGGGCTGG
TTCTGACAACGAAGACTGGCGACACCCTGACCATCAGTATCCGCAACGGCATATGGTACATTAACAACGGAGCAATCACG
CAGGCAAACCTCGTATTGCAAAATGGGGTGGCTCACGTCGTTGACCAGGTACATTCCCCAATCCCTCCCACTTACTTTAC
TGATGGCCTGTCTAACTGTTCCAATAGGTTCTCGTGCCGACCCCTGCCAAAGCTGTAACCTCATTTGGACATCCGTCCGT
CAATCTCGGGCTGTCTGCCCTCCTGTGTGTTCCTCTGATTTTACTAAGCCTGCTGTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62