GenePrediction:GLEAN_5647 Details

Name: GLEAN_5647
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1839951..1838370 (- strand)
Length: 1582
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1839951..1839754 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_173:1839695..1839568 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_173:1839506..1839465 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:1839410..1839344 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_173:1839292..1839252 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_173:1839011..1838735 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_173:1838606..1838370 (- strand)
Length: 237
>GLEAN_5647 class=GenePrediction position=GCSC_173:1839951..1838370 (- strand)
ATGACCGAGATGGAGGAGAATGTTAATTCAGCTGCTGAGACATCGGCCGCATTTTCGGCAGCAGCCCTAGCGGCAGTAGA
GCCGGCTGCCTCTTCGCCTGCTCCTCCGGCCGCATCTCCGGCTGCTATTTCGCTTACTCCAGATCCGCCGACCCAACTCC
AACTCCCACACACCTGGACGGGTCTAGAAACTCTAGAGGTACTACTTTTCTAGATAGATTTAGAAATGAGATTGGATACG
ATTTGACGCTCTCTAGGACGATGGTGACTCCGCGCTAGGTGAAGATATCGCCAGCTCCACGGCATCCATCACGTCAAGCA
TCCTGAAGTTTCGCGTACTCAATGGGCGTACGTACCACCACGAGCTTGGCGAGAATCATTACTGGTATGCCGACTGCAAA
AAGACTTGATGATCATTGCTAGCACTTGGCTAACGGAAGCTCAAGGGCCCCCAACGATGACCGCCAGAATAACACGCTCG
ATATTGGGTAAGGCTTGGTTACCTGCTAATCATAAGATTTGAGTTTCTAACTTACCACTAGGCATCACACCTACACGCTG
CTTATGGGTGGCAAACTCTTTCTCGCGCCCTTACCAGAGCATATTGATGTAGGTAATTGCAGGTTTCTAATAGAGCATCA
CTAACAAAGTGTTGTACAGAAAGCCGTTGATATTGGTACAGGATCGGGAATTTGGGCTATGTATGTAACCTCCCCATTTA
GCACCGCATTTTATCACGAGGTCTCTTTATCACAAACGACAAACGAAGGCTAAGTAGAGACAGCGATTTCGCAGATGAAC
GCCCTGACACAGAGGTCGTGGGTACTGATATTTCCCCTACGCAGTCGACTTGGGTGCCTCCAAATGCATATTTGTAATCA
ACTCTCTCTTTGTCCTGCTGCTTCTAAACTTTTTCTTCGTTCTTACTAATGACCGGTTAGCGAAATCGAAGACTTTAATG
AGCCATGGACGTTCGGCGACAACTCGGTCGACTACGTACACCTTAGATGGCTGGTTGGCTGTGTACAGGACTGGACGCAA
CTGTTCAAGAATGCATACAGGATTCTTAAGCCTGGTGGCTATATTGAATCCCTTGAGGTGGACGGCAGCCTCGACTCAGA
CGACGGCACCGTGACAAAGAAGACGGCGTTGTCCCAGTGGGGACAAATCTTTCAAGAAGGGGCACGAAAGCTTGGCTCGC
TCGCTTCATTCAACCCTGTTATGGAAGGTTTACAGCGCCAAGCTCTCAAAGATGCAGGGTTTATCAACATTACGGAAACG
CCATACAAGGCACGCTAACAGCCTTTATCGCCTTGCTGCCACATCTCGCTAACATGGAAATCTAGGTCCCGTTTTCTGAA
TGGTCGGAAGACCCGGTCCTGCACGAAGTCGGTCAGTTCACTCGTGCCGCCATTTTCAATGACATTGAGGGACTCGTCAG
CGTGATGGCTACCCAGCTCGGCTGGACTCCAGAGGAGATTACCGTCTATGCTGCCCATCTGCGCCGGGAAATGCGGGGCC
TTAATGTGCATGCGTATATGCACGGCTGTGTAGCTTATGCGCAGAAACCACTGGATGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62