GenePrediction:GLEAN_5648 Details

Name: GLEAN_5648
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1838123..1834507 (- strand)
Length: 3617
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1838123..1836369 (- strand)
Length: 1755
Type: CDS
Source: GLEAN
Position: GCSC_173:1835997..1835899 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_173:1835604..1834507 (- strand)
Length: 1098
>GLEAN_5648 class=GenePrediction position=GCSC_173:1838123..1834507 (- strand)
ATGCCTCGATCTCGGAGCAGCACGGCCACGATGACGTCGTCGTCACATGCCACCTCGCGGCCCAGCTCTCTGTCGCAGGC
AGAGGCCAGGTCGCGCAACAACGGCCACGATAGCGACGAAACCCATCCTGACGACAGCCACGACAGCCACGACAGCCTCG
ACAACGACGATGGCGACGACGGCAGTGCGATATCGGTACCGGTAGAGACGCTGGTGGAGCACCTGCTGGCGGCACGACGG
GCGCTCGGGACGATCAGCCAGGTGCTGCGCGGCAACGAGCTGGCGACACAGGCACACCAGCTGCACGCAGAAACAGTAGT
GCTAGCAGCACAGACGGCATTTCTGCGACAGGGAATCCGCGACCAGGTGGACGTGCTCGTGCGAATGCGCAGCGGCATGG
GGCGGGCATACGAGGTTGGGCGGCGGGAGTTCCGGCGGCTGATCCGGACGCTGGACGCGGCCAACGGACAGCTCGAGCAC
ACAATGGCCATCTTGCGGGCGACAACGGTAGCGGCCATCTTTCGGCCGGAAGGCGAGGATCCGCGGAACCTGCTCGACTT
TGTGGACGAGTCGGGCGTGGCGGCGCTGCAGAACGCGATCAAGGAGAGCATCGCCGAGCTGCAGGCTGCCCAGACGTCGT
TTGATGGCGACCTCCTCCGGTTCGACACGGATCTGCGAACGCTCAACAAGACCATGGCGGCCGCCCCTACGACGCCTCCA
CCACTGCCACTGCTGGTCACAGCCGAGGACACAGATGGGCAGCAGGGGTCAGGGCCGACGATGCCGCATCTGCTGGCGTC
GCTGACGACACGGTCACACGCCATGGCCGAGAACCTGTCGTCGCTGACGCGGCATTTTGACATGTGTGTGAAGGCAGTGC
AGACGACCGAGGGCAAGTCTGCCCTAGAACGATGGCAAGCAGCGCAGTCGCAGGAGGGGGCAGAGGAGACGGAGGAGGGG
GATAGCGGCCACGGCAACCACGACAACCACCCGGTCTCGATCTCGGGGGTGATTGCCGAGCAGGAAGCAGCGTCAGGACA
GGGCGGCCTGACAAACCTGGAGCCGATCTCAGCACAGGAGCGGGCCGATATTCTGCAGGTGGTGATGCAGGACGCAGGCG
AGGTGGATTATGCGGTGGGCGACACGGCAAATGAGCTGCACGCGGCCGAGGCCGAGTTTGCGGCCGTGCGGGCACACCAC
GAGCAGACGGCAGCGGCCTTTGCGGCGACGGCAGCGACACTGCGTGTGCTGGACGACGTCGGCGGGCGGCTGCCCAGCTA
TGCGGCAGCCGAGACGGAGTTCTCGGAACGCTGGGCCCACGAGCAGGCGGCCGTGGCCGACCGGCTCGCCGACATGGACG
AGCTGCGGGCCTTTTACGAGGGCTATGCCAATGCGTATGACACGCTCATCCTCGAGGCCGAACGACGACGCAACGTCGAG
GCCAAGATCCAGGCTGTCTGGCGCAAGGCCCGCGATGCTGTCGACCGTCTCGTCGTCGCCGATGCCGCCGAGCGCGAATC
GTTCCGCCATGACGTCGGCGAGTACCTGCCTACCGATCTCTGGGCCGACATGGACCGCCCGCCGCGCGGCCACGACCTGT
TTTCCGCTGCGGCTGCTGCTGCAGCTGCTGCTGCTGCTGTTGCTGCCACGACAACCGCGGCTGTCGGTAGCAACAAGACA
ATGGACGGCACAGACGAGTCCGGTCCCGACCCGTCGACCAGCAGCAACGGCCCAGGCGGAAGCAGCACCAGGACAGTGCT
CGGACGCTAGATGCCGTCGCCGTCCCCTCGGCTCTGCCCTCTTCTCCTCTTTCTTCTCTTGTACGGCGCGTGGGACGGAT
TCGGCATGGCATGGAAACAGGCGTTTGGCACAGGGTCTCGGATCGATTAAATACAGCATGGCCGAAGACGGCCAGACGAC
CACAGAGCGGCATGGCATACATAGGCAGTGCGCAGGACATACACGTGCACTATGTGGCTTCAACTAGAAGCAGAAGTCCT
GGACGGATTTCAGTGTTTCTGGTGTGTAGCCGTTCAATGCCATCGGCGCTTCTGCCGCTTCTCATTTCAGCTCAGTGATT
TCTATGCGATGGCTGCTATTGGCTGGGCCCTTGTCTGCGCCGGCAGGACCGACAAGTCGAAGACTGGCTCTCCGTCATGC
TCGTCGTCTCGCAGAGCCAGCACGTGGACTCGAGGGCGGCCGCGATTGGGCTGGAGACTACTAGGGTCGGCAGCCAATGA
GCGTATCGGCATTAGCTTCGCCACAGCGCTCTCTTGGCGCCTTTTTCAGTGGGGCTCGCCGCTATCGTCGCTCATCCTTC
TTGCCCAAAGCGGCCTGGCTTTTCTGTCGGCATGGCCATCAACATCGAGGCAACGCGATAAAGGCCAAGCCTACACTGCA
CCTCGCCCAATCAGGCCTCTGGCCAGAGACACGCTCGTGCGCAGGCTGCCGGGGTCCTATCTTGTCCAATCTGACCTACG
AAAGCTCGTCTGTCATGGCTGTTTTACGCGCGCGATCAGCTTCCCTTCAGAACTGCTCCATCTGCAGGAAAAGACCTGGA
CGACATCAGCCCGAACATGAACATGCTCCTGGACACGGTCGGCCTTGGCCATGCTGCCTCGGCCTCTTCCTCGTGCGCGC
TTCCTCGCTATGTGCCCCTCGACAGCAAGCCGGCCGGTCGACGGCTCTCGATCGACGACGCCGAAAACAACGACGGCAGC
TCGGCCTCGCACGCGGTGCGTCACCGTCACAGCTGCCGTCCTCGCCAGCGGGCTGCTTCTGCTGCTGCTGCTGCTGCCGC
CGCTCTCCCATCGGCCAGTAAGGCTCGCCTCATCCCGTCCTCGCGCCGCTTTTGGGCCGACTTCACCCTGGGCTTTGCAG
ACGGCCTGACCGTTCCTTTTGCCCTGACGGCCGGCTTGTCGTCCCTCGGCCAGACGGACACCGTTCTGTCTGCCGGCCTG
GCCGAAATCAGTGCCGGCTGCATCAGCATGGGCATTGGCGGCTATCTGTCCGCGAGACAGACGTCGTCCGAGCCGGAGCC
TGTTTTCCCCGACGGTGAGGAGACGGATGAGAAGAGCCCAAGGCGCCGGGAAGACGAGCATCTGGCCACTACCGTGGCCC
ACCGCTACCTCGAGCCTCTCGGCTTGCCGCTCGAGCTGCAGCAGCTGGTCCTCAACCACATCGCCGACCAGCCGCACGTG
ACCGACAGGTTGGTCGCAACAGCGCTCGACCAGGACGACGATGAGGACGACGACAACGACAACGACGATGGCGATCTCGT
CTGGCCAGTGTCTGCCGGTCTGTCCGTGGCTGGCGGCTATCTGGTCGGCGGCATGCTGCCCCTGGGGCCCTACTTTTTTG
TCACCAGCGTCGGCGACGGTCTGCGCTGGAGCTTCGCCGTCTGCATCCTCGCCCTCTTTCTCTTTGGCTTCGTCCGCGAC
TTCTGCCTCTCGGGCACCGGCGAGACTGCCCGCCAGCCGGCCATCCCATGGCGACGGCTCTGGAAGAGCACCTGCGAGGG
CCTGCAGATGGTCGTTCTCGGAGGCATCGCCGCCATTGCCGCCGTATTGTGTGTACGCCTGTTGGAAGACGCCAAGAGCG
GCCAGGACAGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62