GenePrediction:GLEAN_5650 Details

Name: GLEAN_5650
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1809558..1807476 (- strand)
Length: 2083
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1809558..1809279 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_173:1809205..1809108 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_173:1809035..1808460 (- strand)
Length: 576
Type: CDS
Source: GLEAN
Position: GCSC_173:1808269..1808214 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_173:1808136..1808078 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_173:1808001..1807859 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_173:1807796..1807476 (- strand)
Length: 321
>GLEAN_5650 class=GenePrediction position=GCSC_173:1809558..1807476 (- strand)
ATGACGCGCAAAAAGGCCCTCATCATCGGCATCAACTACACGGGCAGTGCCCATCAGCTGAACGGCTGCATCAACGATGC
ACGCAACGTGCGGGATTTTCTCGTCAGCGACCGTGGCTTCTCGGACTCGCCCCAGGACATGGTGATGCTCACGGACGACG
CCGACAACGAAGGCACGCCGTACTGGCCGAGCCACTCGAACGTGATGGCGGCCTTTGGCTGGCTGTCGAGCTGCAACGAA
CCGGGCGACGCGCTCTGGCTGTCGTACTCGGGACACGGCGGTGGGTTTGGGCTGGGACTCTGGTCTCATCTCTGAAGAGC
TGTTTCTGTCTGGCTGACGATGTGGCCATGCAGGCCAGACGAGAAACGCGCAGGGCGAGCGGGCGTCGGGCTACGACGAC
ACCATCTGTCCGGTAGACTTTGAAAAGGCCGGCCAGATCGACAGCACGACGGTGAGTCTTGGACTGGTTCCGCTTGCCGT
TTTCTTTCTTCCTTCTCGCTCGTCCTCCCGGCTAACCTCCCAGCTCCATCGCGCCATCGTCTCGCCCATGCACCCCCAGG
CCCGCCTGACGATCCTCTTTGACTGCTGCCACTCGGGCTCGGCCTGCGAGCTGCCCTACGTCTTCCGGCCTGACGCCGAC
GGCAACGTCAGCATTGCCGACACGGTCCAGCGCGGACTCTCGCTCTTTTCCGAGGCCCATGGCCTCATGCGCGGCGGCTT
CTCGCTCGACAAGGTCTCGGCGGCCGAGCAGCTCTTCGCCAGCACCTCAGACTTCTTTCACAGCCTGCACGCGCTGCGCA
ACGGCGACAGCGCCGACGAGAACGACGGCCTGACCACGCAGGATGCCCAGTGGGCATCGGAGCAGAAGGACGTGTGGATG
TTCTCGGGCTGCGCCGATGATCAGACGTCGGCCGACGCCACCATTGGCGGCGCCGCCACCGGGGCCATGTCCTGGGCCTT
TATTGGGTCCATGCGCGAAAACCCGGACCTGAGCTACGTCGAGATCCTACAGACGACCCGTCACCACCTGGCGAACAATT
ACGCGCAGGTGCCGCAGCTCAGCTGCGGTGGCCTCTATGACCTCGACCAGCGGCTGGTGGTAAGTGCTTTTATTTATTTT
TTTCCTTTTTTTTCTTTTTGCATTCCCCCCCGCTTACCGTGACCAGCTTTGATCGTGTAGTAGAGATGTAGAGATGTAGA
GGCGAGAGTACAGTAGACCAAGCTGAGCGTTCTGTATTTGCCCATTTGCACTGATTTTGATCACGTGATGTGCCCGTTGT
ATCTTACAGTTTCTCGCCGAAGCTAAGCATCGCCGGCTGCAACGTCCAGGCCCGCAACACGATATGTGACGAGCCACTGT
CCCGCGCATGCTCGCAAAACGACGTACACCACACGGCCCAGGGCAAAGCTTTTTGAATACAGCACAGCAGCCGTGATGGA
CACCGGCCCAGCCCTGAAGGGCGACGTGACAAACCTGCTCGGTACGATTTAGCTCGTTTGCTGGTGTGAGAGAGGGGTTC
GTTGCTTTGGGCCGTTCTGCTGACACGACGACGGCAGACCACGAGGCCAAGTTGATTGCCAACATGCTGCAGCACTACCG
CGAGATTGCGCGGAGCGCCACGGTGCGTGTGTCGAACCGGTCGACGGTCGGCGAGGCTGCAGCGAACCGTCTGCGGATGG
AGACGGAGGCAGGCGGACTGGTGCGTTCTGTTCTCCTGTTTTTTTTTGTTTTTTTTCGTTTTCATCAGTCCTGACTCCCC
AGATCCAAACGGCCGAGGACCTGCTCAGCCTGACGCGGCGCATCCGCGAGCTGTGGATCATCGGTCCGCTGCGCAAGGCC
GGCGAGGGCGACGTCGAGGCCGAGACGCGCATCCGCAGCGAAGTCGTGCCGGTGGTAGATCAGATCGACGGCGAGCGGGC
TGCTCGTCGTGCCCGGCTCATGGGCACGCATGGCACATACCAGGCGCGTCCGTGGCAGCCACCGGTACCGACATCGTCGT
CTGCGGAAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCACGACCATCTACACAGATATCGGCACAGCCAGCACCA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62