GenePrediction:GLEAN_5651 Details

Name: GLEAN_5651
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1800244..1791844 (- strand)
Length: 8401
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1800244..1799452 (- strand)
Length: 793
Type: CDS
Source: GLEAN
Position: GCSC_173:1799391..1795538 (- strand)
Length: 3854
Type: CDS
Source: GLEAN
Position: GCSC_173:1795442..1795333 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_173:1795280..1794468 (- strand)
Length: 813
Type: CDS
Source: GLEAN
Position: GCSC_173:1794302..1792135 (- strand)
Length: 2168
Type: CDS
Source: GLEAN
Position: GCSC_173:1792075..1792019 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:1791941..1791844 (- strand)
Length: 98
>GLEAN_5651 class=GenePrediction position=GCSC_173:1800244..1791844 (- strand)
ATGGACCGAGACTCGAGATCCCCCGAGATAGAGACGAGGGAACGAGCTGTCTCGTCTGAGCCTACTGGAACTAGGCCGAA
CCCGTTCGAGGACGGCGACGAGAGCTCAAGAAAGCGACGTCGAACTTCTACAATAGCAGGCTCTCGCAGTCGCTCAGTAG
AAACGGTTCATTCATTAAAGGGCTGCGAAGCTGGCTTGAACACATCCCCTCCAACCACGGCAACCTCCAAGTCTCCACCC
ACTGCTACTGAGGACGGCACCATGACCATCGATACAAGCTTGGAGAACACCCCTGAGAGCGCTCCTCACACCCCGGACAA
CACTGCTCCACCAGCCCATGTTACGCTCAGCCTCCGCAACTCGGCACATCGGGTCCTGGACACCATCCCATCCTCTCCTT
GCTCCACTCCACAGAGCCCCATACCTGCTCTTCCTGTCTGGCCGTTAGGTGGCGAAGCTACAACTCTTGAGGCCGGGCCG
TACGACGCTGCCCCAATGCAGCACCCAGCCATTCTCGGGATATTCGGGGCCCTCGGATCAGATAGGGCTGCAGATTCAGA
CTCTCTGCGAGTTTCCCGTTCCGACACCACCAGCCCGCCAGTTGAAGTTATTGGTGGCCAGCTAGAGGATGATGCGGACT
TTGGCATCGCACAGACGCAAGTGATGTTGCTTCCAGATGAGCAGGACGAACAGGGGGGCATTCCCGCCGATCCATCTAGC
GACTTCCCTTACCAGAATGCGACTGAAACGCACGCGGAAATCATGGCAAAGCTGATCAATTACATGTCAACGGGTAGGTT
GCAAATATCCTATGTTTCTAGCCAAAAGATATCTCTGACTGATCGGACTTCAGATGTGCACGTGGCTCAAAACATCAGAA
CATGGATAGACAGTTACCTCCTCTTCGCCAAGGGTGCGCCGTTTGACATGGTTCTTGCATCGTATCGCCAACACCGTGCG
CTTTGGTTCGCTCTTCCGGACTTGGTCTGGGGTGTGCCTAATCTGCGCTCCCCCACCTTTGCGATTCTCGACGAAATCTT
ACGTGAACGGCTCCTCGACTTCTGTGAATCGTTTGCTAACATCACCGCGTATTTCGTCGAGTTTGATTTCGAAATCTTGC
AGCAGAGCCGGTCCCCCGATGAGCTCCAGCCAAGGGATTTTATCTCCTCCCACTACCTCATTGCTCTTTCCAGCATCACC
AGAAGGGAGGTGTCGCCAAGAGACGACGATAGGATCCGTGTGCCTGAGCGCGATGAAATCACCGACATCATGGACCGATT
CCTTTCTTTCCATGATTTTCCCCCCTGTGGCACCCTTCTATTGCTAGATAGGCTCCTACAAGCGCAGATTGCAATGATGC
CGACTACCCCGAGAATCATTGAAAACTTTGGCCAAATATGTGTCATGGCTTCTTTTGTCATCCGGGAGGCCGGCCGGAAA
CTGGTGTTTTCCAACCATCGGCTGCCTGGTGCCACTGTGCTGAACAGCCGCATAGCATTGGGCCACGACATCTTCAAGAC
AGCATCCGCTGCGCTGTCGACTATCATTGAAAACCACATCACGCATCTCACGTACGATAATGCAAGCCAACAGATCTCGG
CTCTTGGAGACATAATTCTCCTGTGTCTTAAGGCAGACAACACGGAGGCTGCAGTGGTTATCGAAGAGTTTCAGTCAGCA
CATCCGGACATTCGGATTGAGTTCATACCCGATGTCTATGCTATGGAATGGCGCTTCGGCATGTTTTGTCGCCTCATCAT
GTGCAGCCAAATGCAGCTGCGTGTCATGGCCGTCACAAACCTTTGTCAGGAACTTGTTTTATGTTGGCGCCGGTACGGAG
AGCATCTTCCCGAGTCTGCCCGCGGAGCCCCCGTGCTGAAGTTGGTCTCGAACTTTCTTGCTGCCACGGGTGTCGTTGCC
TATCTTCTCGGGCCCACGTGTCATCCTGAGATCACTGCCGAGAGTGGTAATATCATTGGTTTCTTGGCCGTGACGCGAAC
ATACACAAATGAACACACCGATCTGTTCTGGCAGACTGTCACCAACACCCAGGACCCGAGAATATCCGAAGCACTGCTGC
GCATGACCTGTCGCATCACGCATCTTTTTTCCTACGATGCTGTCATCTACTTATGCCAAAAGATGCTTGAGCTCCCAATC
TCGGCCTACAATCAGACGATGCGGGAGTTCTGCGATGCCATCCTTCGTCATGTATCCAGTAAGGCCCCATTGGAAGGCCC
CCCACTGGACACGATACCGTTTGCAGTGTGTCTTCACATCCTTCGCGAGTCCTCAGTCCCTGGCCTAAAGACCCCAACGG
CATATCCTGAATTGCAGAGCTTTGCTATTGAAAAACTAGGCGAGTTGCTCAAGAGCATTGGAATCGAGCCAGATCAGCGC
CAAATTTTGTACCGGAGCTGTCTGTCAGACATCAGAGAAAAATCGCCGACAACCCTGGGCAGCCTCTGTGCCATCAACAT
CATCAATCGTCATTTTGGAAGCCGGGACCTGGCAGTGTTGACTACCGAAAACAATCTGACAGAGCTTCTTGTCAATGACA
TTGAACACGCCGTCATCGAAGGCCGACAACTCGGCTCTCCTGCTGTTATAAGTGGCAACACAAATTCTCCACGCCGAGAC
ACAATATTTCAGATTGTTGTATCTCATGCAACAACATTGACGCCTGAACTCAGCGCCCGTCTTTGGAACTTGATGGTTGG
ACCAGGTGCCGCTTGCGCAGATGACAGGACTGCATCCTGGAAAGTTCTTATTGCTTGCATAAAGCGGAGCCGGCTTGAAA
GCAACCCTTTTCTGTCTCTCTGTTTCAGCAAATTTCTTCCTGTTCTGCCGCCGAGCTGCTTCTGCGAGGGCTTGCTGGAA
TTCATACAGGATAACCTTATGCCATTGGTCAACGACGTTAGCAGCATTGTATTGGACGACGAAGATATGAACGCTGATCG
CAGCATCCTGGAGCAACTATGGCGGATCGTCCTGACAGCTCCTCCTGGAACGATTGAACTGGAAGCTATTAGCTTACTGG
TGAAGGATGTCTATATCGAAAGCCGATTGATCTTGTCGTTCCCCCATCACAGAGCTCGCAAGGTCCATCTAGCCTTAGTC
AACCGCTGTTTAAGGCATCTTTCCTCTGCGGCCAAGAAATTGAAGCTATACAACAACGATGGTATATCAAGCGGAGACGA
CGATTCGTTGGTTGTGTTGCCCTCTGGTTCACAGATTCAGGAACAAGAGGCTTTGTTTGTGCGATCCCTTTGTGTTCTGA
AGGAGTTTCATCGCCTTTACCGCACAAAATCCAATTTCTCCGCTCCTGATCTGGGCTCGTACCTGTCGGAAAGTCCTGAG
AACATCAAAGGTGAGCCGGCCCAGCTGAAATACCAATCATTCGATGGTGTCAGCCAAACAGAAGTGAAGCCACTCAACAT
TGGACGGCGCAATACTGCCGGATCTCTCCTTGCCAGCCTCAGAGAGGCAACAGGTTTTGACAACTACCGTGTCTTCTATC
GAGGCCAGGCTTTCATGCCTCGGGAGAGCGATATCTGCAGGCCATTAGAGGAGTTGCGAATTCACGATGGCCTCATTCTT
GTGAAAAAGGAGTCCGATCCACAGACACCACCGCCTCAGGTACGGCCTGGCACATCCCCAGTCGACATTGAAATTCTCGG
GCACTTCAAAGAGCTGTGGGAGTACCTAAGCATGGAGGAGAAACTGGCTCGAGAAATTCACCGATTTTTGTCTGTTCTTC
CCGTTGAGGGCAGCTTTCTGCAGAAGTTTGGCAATCCCGACCTGTCATATAAGGATATTTTTCCGATTGGACAACCCTAC
AAATCGCTCTACGCAGTCTACGGATTACGGGAATATCTTCAGCTACATCGCCGGGCCGTTGGGCCTATCAAGGGCGTCAC
CGGAGTTGGCGGAGAGACTGGAAGCAGTGGGTCGCATGAGTTGGCGACGGACGATTCCCGGATAACAGGGACTGTCCCGG
TCAGTCTAAATGCTCAGGCTCCAAGCGAAGAGCAAAGTTCCGTGAAGGCCTACAAGGAGGCACTTGCTACGGCAAAACGA
CTGTCGATTGCGGCGATCTGTGATCCGGACGTCACTCAGTTCTCTACTAGTGTCGATCTGCAGATATCACTTTCTTCAAT
GCTGATTGATATTTTTGGGTTCATTCTCAACGAAACTCTGAGTTGCCCTCCCCATGCCGACCTCGACGGGACGCTCTCAA
ATCGCCTGATGAGCATCCTCCGCGTCGCAATAGACGCGCCGTCCACCGAGTCGTCGGTCCGACTGGTGCAGCTTTCTATT
GAGGCCATCATTGATTCCTGTGCTGTGAGCAGTTCGTTTTGGGAGGCTTTTAAGCAAAATGAGTCCGTCAGCCAAATCTT
CGGCCAACTCCTTCTCGAGGACCAACGGCAGCACATCCGCCAGCTTGTGGCAAAACGGATTGGGGGCCAATTTACTGACC
AGCGACACTCCAATGCTGTCAAATCCTCCGAGTTCCGCGACTTTTTCTGGCCAATCATTGAAGATCTCATTCCCAAGGCA
ATCCATCACCCTGAGAAGTGCGAGGACATCTTCGGATTGACATGCCGACTTTTTCATATGATGCGTGGCAGCAAATCCTC
CGTGTTAAATATGCCATCGTTTTCGGCTCAGATCAGCAATCTGGTGCTGTCATATACGACCTTCGAGGTATGTTTCTTCC
CTTGATGGTAGCAATCGGCCAAAGAATTGGGGTGGTCCCAGACATGCTGGACGGCATTTCTAATGCGATGCCATAACTAC
AGGATGTCACGCAGCCCGACATTACAGACAATGCTGCCTCTGGACTACTCCAGGTTCTTTCCGCCATCATTCGCACTTCC
AAGAAAACGGATTTTAGGGATTGGTTCCCCGCGTAAGAAACATGCAGGTTATCCTAATCTCTTCTCCGGCTGACTTGTAT
ACAGAAACTTTGTCAACAAACTATTCTGGAAACACCTATTTCCACCTTGGCAATATAAAGCCGAAAATGAAGAGGATGGC
GTTTATTCGAGCCAGTCAACGTTTCCTCGCGTGCTGATAAGCCTAGTGTCGAGAACAGAATTGATAAGCATCATTTCTGA
GCTCATGGATGCGGATAAGACCCAACTTCCGGCCCTTACTCAGAATCTAGATCAATTGGTCCCGTGTGAAAAGTCGGATG
ACGATGAACCGTACCACTACGATCTTCCTCAACAGTTCGATCGAACCAAGGCCCTCCGGGCACCATGCGGTTATGTTGGG
CTGCGAAATCTGTCAAACACATGCTACCTGAACTCGTTGCTCACACAGCTCTTCATGAACGTCGAGTTTCGGCGGTTCAT
GATGAATGTTGAGATCCGCGACGAGACTAACTCCCAGAAACTCCTGTTCCAGACCCGTCTACTTTTCAGCTTCATGCAGG
ATAGTATCCGCCGTTACGCGGACACGCAACAGTGTGTCGCCAACATCAAAACTTATGACGACACGCCCGTAGACATTCAC
AGCCAAATGGACGTGGACGAATTCTACAACCTCCTGTTCGACCGATGGGAGGGCCAGATGGTTTCGGCTGAAACAAAACG
GGCCTTGCGGAACTTTTACGGAGGACAGCTGGTGCAACAGGTGAAATCGAAGGAATGCGAGCATGTTTCTGAACGACTGG
AGCCCTTTTCTGCCATTCAGTGTGATATCAAGGGAAAGGCTAGCCTACAGGAGAGTTTGCAGGCATATGTTGATGGAGAG
ATAATGGAAGGCGGTAGGTTCATCACAACTGTCCCGAATCTTTATCTAGGTTTTTTTTTCAATGGCCACAAGACAACAAG
TACAAATGCTCCACATGCGACCGACATGTCGATGCTGTCAAAAGGTGGTCCTAATACATTCCAGTCCGTTTTTGGGCCAT
CAGAGTGCTAAGAATTAAACAGGGCGTGTCTGAAGGATATTCCGGACAATCTCATTCTTCATCTGAAACGATTCGACTTT
AACCTCCGGACTCTGCAGCGCAGCAAGATCAACGACTACTTTTCGTTTCCGCATGAACTCGACATGCGGCCGTACACTAT
TGATCAGCTGAGCAGTCCATCGGAGAAAAAGTCGGCGGACATTTTTGAGCTGGTCGGCGTTCTCGTACACTCTGGGACAG
CTGAGTCGGGACACTACTATTCTTATATCCGCGAGCGTCCGTCATCCGGCCCGGAAGCAGGCTGGGTCGAGTTCAACGAT
GATGTGGTCAGCGCGTGGGACCCGTCGCTCCTGGAGTTGTCTTGCTTTGGGGGCATCGACCGCAGGCCAAGCCATTTCGG
CGGAGACAGCAGCGGAATAGCAATCGACAAGCCGTACAGCGCTTACATGCTCTTCTACCAGCGGGCGTCATCACTCGCCA
AAGAACAGGAGGCTCTTGCAGCTTCGAAGCGGTCGAGCCCGGTCCGTATGGAGGTACCGGCTGCGATTGCAGACCACATC
CGCTTCGAGAACACGTCTCTTGTGCGGAGACACTGTCTTTATGACCCGCAGCATATTCCGTTTGTGAACAACGTGCTCAA
CAGCGTCAGCAGGAAGTGCTCGGCCAATCACAGACTGGAAAGTCTATCGATGCAGATGGCTCTCAGCCACCTCGATCAAG
TCGCATCGCGCAACCGAGACCTTCCCGACTTCCAGTCGCTGCTCAACAGCATATTGATGGTTTGCCAGAGATGCCAGAAC
TGCTATTTGGCCGTATTCGAATACTTTGATGAGCGGCACGATGTCCTGAGGCAATTGATCCAGCGCAGCCCGGAAGTGGT
TGTACGGCAAGAAGTGAGCAACTTCTTGATACACACTATTCGGGCGATCAAGGAGACCTTCCCTGAACGGTATGGACTCG
TGCTCGGAGCGGAGGATATCGCCTTGTCTTCGGAACAAATGGAGCTTGATCAAAACAATAGCATTCTGCGAAGCGCCGCA
TACATGATGCAGACGCTCTGGGAGCACATCCACGTGTCTCTACGGTCGTGGTATGAGACGTTTGGGTTTATGACTGCGTT
TGTGCGAATGGGCCGTCCAGAGCTGGCGGTCTTCCTGGACATTGACGGCCTCCGCCGTGTCGTCATGGCAATTTCGGCAG
ACAGCAGCTTGTCGATGGAACCGCAGTACGTTCGCATGCTGCAGGCAGTACAACGCCGACTTCCGAACCGCCCTCCCTCG
TACGAGAACATGATCGCCCTGGCCGACACCTTACTTGCAGGCATGTACCCTGACCGGGCGGGAACGCGTTCCCGAGAGGA
GCTGTTCGTGGACGACAACGTCAGCCGGTTCATTCTGTCGCAGAAAAGTGCTGATGGAGACCTGCCGATGACACGGACGG
AACTCATCCTTATGGGTCGAAACTGGACGAACGGATACGGCAATATCTTTGTGGAAAAGCTGATCAGCATCGACCAGAAC
ACGATGGCGGCCGACTCGATCATCATCCGCCTGATGGCGTCGCATCCGCCAATGGAGGGCAAGGTCCTCACAACGCTCAT
GGCGAACATCTCGTCGGACGCGGCAGCGCATTACCAGGAACCGTTCCTACGTGTTGCCAAGATCTTTCTGCGCCATGCCA
AGTCAGCCGATCTGGTGTTCCAGCTGTCAAAGTACATTTCGGAGCAGTGCCGCGGGCTCTCCAACACGGACGGCAGGGCC
TTCTTCGAGGTTCTGGGCGAGCTGTTTTACGGTCGTGCAAACAGCACAGATGGGATGGACCAGGCAGCCCTCATACGCGG
CCTGCACTTGCTTCCATTGTGGGCTCCCGGACTATTGGGCTACTATGACACGTCCGTTAGTAACGACGTGGAGATCTTCC
TGCGAGAAAACCTGTTCCAGTTTGGCACGACGCCGCAGTTTGAGGACAGCCAGGGAGGTGCAGAACGTGCCCTGGCCTTG
ACGTCGGCAGCGAGGCAGCTTGGTCTGGAATGCCTGAAGTACATGAAAATGTTCTTTGTCGACCGTGGTGTGCAAGTCAG
TGCCAACGTGGTGACCGCGTTTCAGCGGGTCGTTGCACAGTGCAGGCCGTACTACCTTGAAGACGATGGAGAAGACGGCG
TGGCGGACGAATTCCACACGCTGGACTCCAGTACGTATTTTTCGTTCTGACGATCCGGCATTCTCAAGGGCGACAGCTAA
CAGATGCAGCCGTGCCCGAGCAGCTGAAACGGCTGGTGGTCGAGGACCTCGAAGAAGATGTTTCCGGTAGGTCGACTCGG
CTCAGATGAGCATCAGAAGAAAGACGGACGAGCAGCTGACCGTGTGAGGGCTTGACGATCAAGATTGGAACAGCTCGCAC
TGCTCGTCGGAGCCGGTTGACAGCCTTGGCGATGTCAGCATGCAGACTGCGGCGGACCTGAACGACATGGACATGCCGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62