GenePrediction:GLEAN_5652 Details

Name: GLEAN_5652
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1790458..1788267 (- strand)
Length: 2192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1790458..1789704 (- strand)
Length: 755
Type: CDS
Source: GLEAN
Position: GCSC_173:1789629..1788267 (- strand)
Length: 1363
>GLEAN_5652 class=GenePrediction position=GCSC_173:1790458..1788267 (- strand)
ATGTCGCTCAAGAGTCTCATCTCGTCGCCTCTCGAGGCCGGGCCTTCTGTGCTCGATGCCCACCGGCTACCGTCGCACCT
GGACGCGGCCCTGGAGTACGCATCTCGCCGGCTGGCGCGCCGCAATTTGTCCATCGACCTCGTCGTCGTCCGGCGACAGT
ACCAGCTGCCCCGGGCTTGCAGCACCAGCACCGACGACACGATCATCCGAGATTTGGCCGACGACGACAGCGGCAACGTG
CAGGCCGCCCTTCCGTGCTTCCCGCCGCGACCGGCCCAGGCCAAGGCCCTCGGACTCAGACAGCTGCCACCACTGCAGCC
ACCAGCGGGACGATCCCGCTTCACTTCGGCCATCAAGAGCCTCGTGCGGTCCAGCACGCTGCCGAGCCTCAAGTCGGCAC
CCCATCCGGCCTATCTGTCGGTCCACACGGTCTCGCCCCATCGCTCTCCCTCGCTCGGCTCGGCCTTCTCGCCAACCAGC
TCGGCGCTGCCGTCACCGTCCTCCTGCTCCGAGTCCCTGACGTCCGCCTCAGCATACCCTTCGACGCCGTCGACGCCGGG
CACACCGGATACGCCGGCCCTCACGGTGGACTCGTCGTCTGGAACGAGCGCCATGACGTCGGCCGTCGGAGGCTGGCGGC
CATCTGGCCACGCCGACACGTTCATCCGGCTCGTCCATGCCGACAACCTGATGCCCAAGGAGGAGAGACAGCTACACCAG
GCCTTGGACAAGGCAGCACGCAAGTTCCACCTTTGGTAGGTTTGCGTCTTTTTGTTTTTGTTTTTCTGTCTTTTCGTTCT
CCTTGGTTCGGGTCCTCTAACGCGGACAGCCCCCATCAGCTGACCTCTCCGGTGGCTGCCCATACGCTTGGCTTGCCAGA
TGGTTTCCTGCGCGCGTCGGTCGAGCAGAACGAGATGCTCCTAGCCGGGACAGGGGGACTGCGGCTGCGCTCGGCCGATC
ACCTGTACACGTTCAAGGCGGCCCTGTGCAGCTATGCCCAGACGGGCGACCGGTTCCGGCTCGAGGACGCCGTGGACGAG
CTGCGGCGCTACGTGCTGGCGCGCGGTGGGCAGCGACTGGCCAAGCGCGCGCTGCTGCGCAACTACCCGACGCTGCGCTT
TGCCGAGTCCGATCTGGCCGACGTTCGACATATGTACAGCCGCGCGTACGGAGGCGTCGAGCGTGACTGCGGCATTGAGG
CTGACGGACTGAGCTCTTGTCCGCTAGACGATGGCAGACCGGTGGCCATGTTCTTGGGTGGATGGCCGGATGGCAGTACA
GAGGAAGATGGTGATGGTGGTGGCATTGAAGCGAATGGAGAGAAAAAGGGCGAAAACGGAAATGACGAAAACGACGAAAA
CGACGAAAACGACGAGGAGCAGACAACACCAACAGCCATGACAGCAGATGGTGCAGCCTCAGCCTGCTCGCCCTCGACGT
TGTCGTCGCTGTCGTCGCTGTTCTCGCTATCGCTGGCATCGTCATCCGTCGTCCTCGGCCTGGCAGCACAGCAGCGACGA
CGACAGCGCAAGCAACAGCTGCCCCTCGACGAGGAAGCGATGGAGGAGAGATGGCAAGCGGTGGCCGAGGAGCACACGTC
CTGGTTGGAGATGAACGACGACGACGGATACGCAGAGAGGAGCGAGAGAGAAGACAAGCTGCTGGAGAGCGGCAGTGTCA
AATCACGGCTCGTCCTATCGGCCCCGTTGCCTCCACAAAAGTCGCCCCTGCTGCCCGTCCTACGACTACAGACGACCTTT
GACAACAAGGGACAGACCGGCCATGGAGCTGGCAGGCGCAGGGTTCCGGATCCTGCTTCGGCAAAGGCAGCGGCTGTCGT
CCGAGACAGGACGAGAGACGGCGAAGAGGAGGACGAGGAGGAGCAGCTGACGGCACGGCCTGACAGCCACAGCCACAGGA
GTCCTGGCGGCGGTAGCAATAGCGGGAATAACAGCAGCAACGTCTGGTGGGCCGTGGCGAGCATCGGCGAAATGCTGCAG
GAGGAATGGAACAGCAGGAGAAGCGGCGGCAGTGGTGGCAGCTTTGGCAGCCCGGGAGGATGCACAGCAGAACTGGTTCC
GCCAACGCCAAACCGCTACGACGACATCTCGCCCATCACGCGCAGCGAGTGGGGGTTTCTGATGGGCGGTCAGCAAGGAC
GTCAGGTCGCGGTGACGACGACGCTATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62