GenePrediction:GLEAN_5654 Details

Name: GLEAN_5654
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1778070..1777284 (- strand)
Length: 787
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1778070..1777834 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_173:1777772..1777284 (- strand)
Length: 489
>GLEAN_5654 class=GenePrediction position=GCSC_173:1778070..1777284 (- strand)
ATGAACGACCTCCCGATACGCTGCCTGCGCCGATTGGCCATGAGCGGCCGGCCGACGGTGACCATGGCAGCCTCTGCGAC
GTCGTTCCTGGGCGCCCGGGCGGCGTCCACGTTCAAGCGCTTCCACCGGCCCAACATGGAGCTGACCAAGTTTCCCGACG
GCCACGGCGAGCAGATCTGGATCTTTGACAACATTGCGACAAACCAGGTGGTGTACTCGCACACGCCTATCTTGCGGGTG
TGTTCTCTCTCTCTCTGCCTCGGACCGTGTACCTGGCCTGTTCGCCCTAACTCCTCAGAACAATCGGGCCCTTCGGCAGC
TGCCCTTCAACGGCAAGCAGACCAAGCCGGTCAAGCTTCGCAAAGACTACTGGCGGCCGCTCGCGCTGATCCAGTTTGAC
GCCGGCGCCGGCGTTGTCGGCCGCTCCGTCTTCCAGAAGCTGCGCGAGTTCCGCCGCCTGCACGAGCTCTCGTGGGGCCA
CCAGGCCTCCGACCTCTACGCCATGGACCGCAAGGCCCGCGGCGCTGCCCTCTGTGACCAGCGCGCCAACAGCATCGCCG
ACATGGCTGCCGTCCTCGCCGGCGCTGGCCACGGTAACCGCATCCGGCTGTCGGCCGACAAGGACCAGGCTGCAGCCTCT
ACGGCGCCGGCCACCCTCACCGAGGCCACCGTTTTCTGGGCCAACGACGCCGACATCCAGACCGCAGAGTCCTGGTCCAA
AAACGTCGTCCACGTCGCCGGCATCCCGACGCTGAAGGCGGCACCGGAAACGGTGGAAACAGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62