GenePrediction:GLEAN_5655 Details

Name: GLEAN_5655
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1764491..1761051 (- strand)
Length: 3441
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1764491..1764461 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_173:1763997..1763595 (- strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_173:1763513..1762208 (- strand)
Length: 1306
Type: CDS
Source: GLEAN
Position: GCSC_173:1762133..1761051 (- strand)
Length: 1083
>GLEAN_5655 class=GenePrediction position=GCSC_173:1764491..1761051 (- strand)
ATGGCACCATTCCGCTTCGAGTTCCAGTGCAGTACGGAATACGTGGGATGACTCAGCCGTGCACGGTTGTGCTTCCCCGC
CACAAGCCCCACTGAAGCAGCGTCGCCGTGCCCGGAAACAACGCGTAAACGGCATTGTGCCTCAGTGTGGCTCCGACTTG
GCTTGGGAAGGCGCAGTCGTTGATTCTGCCCGGTGGCCATAATCTGCACCCAAGGACACAAGGCTGGAACCTAGCAGTTT
AAGACTTTAAATGATTGCAAGCTATACGCCTTTCCCTATCGACGCCAAGAGAACAGGAAGTCTGGTAATGCATCATCCTC
TCGAACCTGCCGATGTCATGTCAACAATACCGGCAACTTGAGCTGGTGTCATTTCTCTTCCTCAATGCCACCGGACGTTA
ATCAACCTCAGAGACGATGTTAACGACACAAATAGAGGCACAAGCCAAAGTACGCCCCCGTTCCTCCGCGACACAGAGCT
CTAGCTGACCGTAGAGCAGGAGCGGGAAGCGCTGGCGAGCCAATCTGTGGGACAGACGGCATTGGATCATGTCATTACTG
CAGTGGAGCTTTACATGAAAGCCGTGCAAGAAGCCACGAGCCCGGTCGAACGAAGCCGTCTCCGGCGGAAATGCAAGGAG
CTCATGGCACATGGAGAGCGCCTCAAGGCGGCGGCAGCTCCGGTAGAAGCGGCCATGTCGTCGTTGTCACTTAAAGGCGC
TGCATCGAGCTCGGAGCCCAAAGACCCCAACCCAAGACTGTCTCGGGAGCTGTCAAAAAAAGAGCAAATCATCCTCCTCC
GATCATCTCGCCTTCATGGATCTCTGTTTCCGCCTTGGGAGACAGAACCACCGAACGATATGTTCAGCCTCTCTAATTCG
AGCAGCGCTCTTTACGAGTATGTTGGCATGAGCCTTGCAGGGCTTATATGGTAGTTGTCTTTCTCTTGGTTCTAACACTC
TCTCGGCATTGTTGACAGGGACAATGTGGAATTCTCCATGTCAAAACAGCAATACAAGGTGTTTGCAGGCTGGAGACGGC
CAGCTGAACTTTTCCCAGAGCACAGCCAAGCCGACGAACAGCTTGCGCAAGACGCGCAAAGCAACATGTTTATGCTGGCA
AACCAAGAACCCGACTTGGTACAGGACATCACAACGGACTGTTCCGTCGTGGCGAGCATATGTGCAATCGTAAGGCATAC
AACGGGCCACAGCGACCGGCCATCGCTGCTGTCAAAGATTATGTACCCGTACGACCACTCGAATGACTGGCCTCTTCTTT
CGGAGAACGGAAAGTACGTCTTCCGCATGTTTTTCAACGGAGCCCCCCGCCGAGTGGTTGTGGACGATAGGCTGCCGTCA
TCGACATCGCGAACGCTTTTTGTGGTTGACCGGCAAAACCCGACGCTGCTCTGGCCAGCACTACTGGAGAAGGCGTACCT
GAAAGTGCATGGCGGTTACGATTTTCCCGGAAGCAACTCAGGAACGGATCTCTGGGTCCTCACGGGGTGGATTCCAGAAC
AGATCTTCATCCAGAGCAAAGAGGAACAGCCAGATCTTCTCTGGGAACGCATAAAAAAGGCTTACGACAGCGGAGACGTG
ATGCTGACCTTGGGAACGGGCCGTCTTTCGGCCGAGGAAGAGGGACTCGGCCTCGCCGGCGAGCACGACTATGCGGTCCT
GGACATACAGGTGGACATGGCGGGCAACCGCCGGATGCTTGTGAAGAACCCGTGGTGCGACAATCTTGTGTGGCGCGGGA
TTGGCATCTCCCCAGATGCGGCACTGCCTGAAGCGACCTCCTCGAGCACCGTTCCGACGGCGGCACCGATGACGGGCACG
TTCTGGATAGGATATGAAGACATCTTGCAGTACTACGAGACGCTGTATCTGAGCTGGAACCCAAGTCTCTTTTCCCATTG
CCAGCACCACCACTTCAGCTGGACGCTTCCGTCCAAGGCGGCGGCACATTCGCTCGCACACAACCCACAGTACGCGTTTC
AGCCTGCCGACGACGGGACGGTGTGGATTCTGCTGAACCGGCACTTTCAGGATGCCGATCTCGATTATGCGCGCCAGAAG
CGATATTCAGAGCAAGCCGACAAGACGCCAGAGGATGCGGCAGCCGGCCAGCCGGGATACATTGCACTCTACGTGTTCGC
AGTCGACGGACAGCGGGTGCAGTTACCGGACCGACCGCGGTGGACGCACCGGGTTCCGCTGGTGGACTCGCCGCAGACGC
TGCTGCGGTTTGAGGGCCGCCGGGCCATGCGATACACAGCCGTGGTTTGGCACAGGCACAATTGCCGCTGCCGACGTACG
CCTTCAGCCTGTCGTTCTTCTCGACAGTGCCGCTGCAGGTAGAGCCGGCCGTGGATGCGCTGGCCTACTACCAGGAGGTA
GCGGACGAATGGTCGATGGAGACGGCCGGCGGCAGCGCAGCATCGCCCGACTTTGTGCGGAACCCGCAGTATGCCCTGAC
GGTGCCGACGGCGACGCCGCTGTCGCTGCTGCTATGTGCCGAGAGCGACGACGTGCCGCTGCGCGTCGACCTGGTGTGGG
CCCGAGGTCGTCGCGTGGCCTCTCTGGCGGTGCGCGATCTGGTCGTCTCGTCGGGCGAGTACCATCGCGGCTCGGCGCTG
GCGCTGGTGATGCCGCGAGGCGTGTCTGCCGGCAGCGTCCGTTCTGGTGTCGGCAGTAGCATTGGCAGCAGCGGCAGCGC
CGGATTTGGGCCGGGGACCGTCGATGCCGGCACCTATACCGTGGTCGTGTCGACGTTTGAGCGCGGCCAGCAGACACGTC
TTGTCCTGCGCGTGGGCTCGGCCGTTCCCGTGACCTTGCAGCCGATCCCAGCAGAAGACTCGGGCAAGCTCCGCACCTCT
CTCGAGTCGCTGATGCTGATGCTGGACGGCAGTGATGACAATGGCGATGGTAACGGCAACGACGACGACAACACGCTGCG
CTGGAAGGCCGTGATGACAGCGCCACGGCTCAGCACGCGTGTCAGCCTGATCGTGCAGGCCGTCGAGAGGGCAGCAGGTC
GCACGTCGGGCACGGCCGCAGCCACGACCACAACAGCAGCTGCGGCGGCCGCGGCCAGCACGACACTCGTGCGAGTGTCG
GTGGAGCGGGTGGCGACCAGCAGACGGGCCCGCGGCCACGAAGTGCTGGCATCCACCGGCAACGGACAGCTACTGGCCAT
TCCGGTGGCCGGACTGCGCATCGGCGAGATTAGCCTCGGAAGAGCCTCCTCGGCGGCATACGAGGAAAGGCTGGGCATCG
GCGTGCCGACTGCGACGACCAAGGCAATGCCCGAGTTCCGCATCGTTGTCGAGGCCCGCAGCAGCTGCAGCGGACGGCGG
CTGCAGCTACGGAACGTGGGCATCCGGGTAGACGTCCTGAGCACCGATCGGGTGCAGATTCAGCCCTGGACAGCTGCATA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62