GenePrediction:GLEAN_5656 Details

Name: GLEAN_5656
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1754513..1752989 (- strand)
Length: 1525
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1754513..1754435 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_173:1754347..1754293 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_173:1754209..1754063 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_173:1753996..1753414 (- strand)
Length: 583
Type: CDS
Source: GLEAN
Position: GCSC_173:1753360..1753332 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:1753245..1753153 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_173:1753085..1752989 (- strand)
Length: 97
>GLEAN_5656 class=GenePrediction position=GCSC_173:1754513..1752989 (- strand)
ATGACAGCAAAGACCATGAAGGCAGTCGTCTTTGACGGCCCGCACAAGATTTCTGTGCAGGATCGACCGGTACCGCAGCG
TAGGTCCTCCGTCCACGTGCCGCTGCATCGGACAGACAGATGCGCTTTCCAAGTACGGAGTACTAACCGCCTCCCTTCTG
CTGCAGTGCAGGCCGACAACGACGTCATCGTCAAAGTCCAAGCCACCGCCCTGTGCGGATCGTATGTCTCACGCCGGAAG
CGGCACTTCTGATTGGGACCTTGTAAGACACATTGTGCGGACCGACTGACTCAGCCGTGTCCAGCGAACTGCATGTCTTC
CGCGGTCTCGAGAAGGCCACGCCCGGCTTCATCATGGGCCACGAGTTTGTCGGCACTGTCGTCGAGGCCGGCTCGGCCGT
CAAGACGGTCCAGGTCGGCGACAAGGTCGTCTCGCCCTTTACGACGTCCTGGTAGGGTTGTGTCTTTCTTTGCACAGCGC
CGGCATCACGATCCGAGCATTCTGACACGCCCTCCAGCTTGGAGTGCTTCTACTGCCAGCACGGCTTCTCGTCACGCTGT
GAGCACTCCGTCCTGTTCGGCTGTCTGCGACTGGACGGCGGACAGGCCGAATATGTCCGCGTTCCCTGGGCCGATGGAAC
TTTGCTGCGGGCACCGGCCGAGGTGGACGACCGGACGCTCGTCCTGATGGCCGACATCTTCCCGACCGGCTTCTTCGGCG
CCCGCAGCGTGTTCCAGCTGCTGGCGCCCAACGTCGCGCCAGCCGAGGCCGTCGTCGTCGTCGTTGGCTGTGGGCCCGTC
GGCCTCTGCGCCGTCATTGCCGCCCTCGAGCACAAGCCTCGACACGTCTTCGCCGTCGACAGCGTTGACAGCCGTCTCGC
GCTGGCCCACCAGCTTGGCGCTGAGCCCCTCAACTTTGCCACCGACCGTGACGGCATGGTTCGCCGCGTGCTCGAGGTGT
CCGGTGGCCGTGGTGCCGACGCCGTCATCGAGGTCGTCGGCCTTAGTCCGGCTCTGCGCACGGCCTACGACCTGATCCGC
CCCTTTGGCGCCATCAGCTCCATCGGCGTCCACAATGCAGAGGCAGGTCCCGTGACAGATGTACAGGTGTAGCTCGATCG
GTCCGCTAACATGCCGTCCACCCTCTTGCTCAGGTCCCATGGTCGGCAACTGATGGATACGAGTGGGTTTCTTTCATTGC
TTTCTTCTGGCTTCTCTTCTTTTGGTTACAGTCGACACTTTCGCATTCGTTGCTCACACTCTCTCTAGCAAGAACGTGCG
TTTCCAGCAGGGACGCTGCCCGGTGCGCTCCATCTTCCCGGACGCGCTAGAGGTGCTGGCAAAAAACCAGGAGAAATTCG
GGTATGTCTTCGCTGTCCGCTTGTCGGCCGGAAAATGTGTTGTGCTGACCTGATAACACTAACGCCAGGTTCATGTTCGA
CAAGATTATGCCGCTGACAAGCGCTGTGGAGGGATATGATCTGTTCGACAACATGAAGGTGCAGAAGGTCGTCTTCACGC
CGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62