GenePrediction:GLEAN_5658 Details

Name: GLEAN_5658
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1748966..1747621 (- strand)
Length: 1346
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1748966..1748883 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_173:1748799..1747621 (- strand)
Length: 1179
>GLEAN_5658 class=GenePrediction position=GCSC_173:1748966..1747621 (- strand)
ATGGCGTCCAAGCCGTTTGTGCCCGTCCTCGTGGCGATGATGCTGCTCACGGGTGTGTGCAACACGCTCCTGACCAAGTA
CCAGGTTGGTAGTTTGGAGAGAGGGATATGTGTACAGCACAGCCATCGAGAAGACTGATTGCTGACAGCCGTGTGCTCGC
TATACAGGACAACCAGTGCGTGCGCAACTGCGACGACCCCGACCCGAAGAAGCATGTTCTTTTTGAGCAGCCGGTGCTGC
AGACGGCGCAGATGTTTGTGGGTGAGATGGGCTGCTGGCTCGTGATCGGGCTGATCTCGCTGTACCGGCGCTATGTGGAC
GGCGGGTTGGCGGCGACGGCGGAAGACGGGTACGAGCCAGTGCAGACGGCGGACGAAGGTGCTGCCGACGACAGCGCCAG
CATCCACTCGACGACGGCGCTGAATGGCAGCAAGCCGGCAGTACGGACGGTAGGCGAGCTGCGCGGTTTCGCGCTCCTGC
TGCTGTCGCTTCCATCGATCTGCGATATCCTAGGCACGACGCTGATGAACGCCGGACTGCTGCTGGTGGCGGCGTCGATC
TACCAGATGACACGGGGCGCGCTGGTGCTATTTGTCGGCCTGTTCAGCGTGCTGTTCCTGCAGCGACACCTGCACCTGTA
CCAGTGGCTTTCGCTGGCGGGCGTGGTGACGGGCGTTGCCGTGGTCGGACTTGCAGGCGCCATCTCGGCCGACACGTCGA
CCGACGCTGAGAGCGGTTCAACGATGACAACCGCGGCGGTGGCCGACTCCGGCACAGAGGCACTGCGGGTGATCACCGGG
GTGCTGCTCATTGCGGGTGCACAGATCTTCACGGCGACGCAGTTTGTGCTGGAGGAGTGGATCTTGGAGCGGTCCACGGT
GGCGCCGCTCAGCATGGTCGGCTGGGAGGGCCTTTTTGGACTGTCGGCCACAGTGTTGGGCATGGTGGTCCTGCATCTGA
CGGTGGGCCGCACCGAGGCCGGCCGGCTGGGCTACTTTGACATGGTGGCGGGCTGGCAGCAGATGACGGCAGACCCGCGG
ATCCTGATGTCGAGCGTACTGATCATGGTGAGCATTGGCGGCTTCAACTTCTTCGGCCTGTCGGTGACGCAGTCGGTTAG
CGCGACGTCGCGGTCGACCATCGACACGTGCCGGACACTGTTCATCTGGCTGGTGTCGCTCAGTCTTGGCTGGGAGACGT
TCAAGGGCCTGCAGGTGATGGGCTTCGTGCTGCTAGTTTACTTTACCTTTACGTTCAACGGGATCGTAGAGATGCCGGGA
CGGATGCTCAAGCCGCCGCGGCCGATCGAGGAACTGCTGCCAGAGGAGCCGGTGGAGCACATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62