GenePrediction:GLEAN_565 Details

Name: GLEAN_565
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:636854..638596 (+ strand)
Length: 1743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:636854..636910 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_97:636987..637769 (+ strand)
Length: 783
Type: CDS
Source: GLEAN
Position: GCSC_97:637830..638144 (+ strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_97:638201..638367 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_97:638434..638596 (+ strand)
Length: 163
>GLEAN_565 class=GenePrediction position=GCSC_97:636854..638596 (+ strand)
ATGTCGTTGGGATACAGTACCTCTGCTACTGTCGGCGCGGCTGCGGCTGTGGAAGTAGTATGTGCTTTTCTTCTCTCTTG
TCTTCTTCTCTCATCTCATCTTTTCTCTTCTCTTCTCTCTTGCTGACTGCTAGGCCCTTCTTCTCCTACTCGGCAAAATC
CTCTACAATCTCTTCTTCCATCCACTGCGTAAGTATCCTGGACCCTTGGTGAACCGGGCTAGCTATCTCGGCTATGTCTA
TGTCCTCATGCGTGGCGATTTGCCTCAGAAGGTGCTTGAGTGGCATGAGCAATATGGTCCCGTGATACGCATCATGCCGG
ACCAGCTGTCCTTTGTCAAGCCCGAGGCCTGGAAGGATATTTACGGCTACAACACGGGCACCGAAGAGATGTCCAAGCTG
CAGACCTTTTACAATGCCGTTGGCGGCCGGTCCATCGTCACAGAGCCGCTGCGCGGGCGTCACCGCAACCTGCGCAGGCT
TCTCGCGCACGGTTTCAGCGACCGGGCCATGCGTGACCAAGAGCCGCTCATCGCCGGCTATGTCGACTTGCTGATTCAAC
GCCTGCATGAGCGCACGCTGCCCGAGGCTGTCGACATGCGGACCTGGTACAACTGGATGGCGTTTGACATTATCGGTGAC
CTGGCCTTTGGCGAGTCTTTTGGCAGTATGGACCAGGTGCGCTACCATCCTTGGGTGGATGCCATCGCCAACAAAGTGTC
GACGATGGGTCTCTTCATCACAGCCACGCTACTCCATCTCCGCCGGCCCCTGATGCTGGCTGCCGGCCTGATCTTTCCGG
GCCGCGAGGAGGTCGAGAGCCTGGCGATGCAAAGGGTCGAGAAGCGAATGGCCCTCGGGACCGAGCGCCCTGACTTTCTA
GAGGGCCTCCTCCGCCAGAGAAAGGAGGACAACATGGTACGTGGCCGAAAACTTCCTGGCTGCCGAAGAAGGCCTGTTGC
TGACCCACAAGCAAAGACGCTGAGCATCGACGACATCGCAAAGAACGCTGAGATGCTCGTGCTCGCCGGCTCCGAGACTA
CGGCCACCCTCCTCACGGGCCTCACCTACCTGCTGCTCCGGAACCGCGCCGTCCTGGACCGGCTGACGGCCGAGGTGCGC
TCGAGCTTTGCCTCTGCCAGCGAGATCACACTCATCTCAGTCGGCAAGCTGCCGTACATGCTCGCCTGCATCGACGAGGG
CCTTCGAATGTATCCGCCCGTCCCCGTCGGCCTGCCACGCGTCGTGCCCGCAGCCGGTGCCATCATTGCCGGCGACTTCG
TACCCGGTGGTGTACGTATGCCAGAACTAAATTTGTGTGCAGCTGTCCATTCTAATTCGACCCCTAGACTGTCGTTAGCT
GCAGCCAGTGGGCCATGGACCACTATAGCAAGCACTGGGTCGGCCCCTATGATTTTACACCAGAGCGCTTCCTCGATGGC
AGCATGAATGCTGGTGACTGTAGGGAGGCGCTGCAGCCATTTTCATTGGGTCCACGGAGCTGTATCGGCCGCAAGTTCGT
TTCCGTTCCTCTCCGCTCATGTTGTTGCTTCCTCGCCCCTGACAGTCGCTGACCTGACAGCCTTGCCTATGCGGAGATGC
GCCTGGTCCTTGCTCGCATCATCTACGATTTCGACATGCGCATGGTCAACCCTTCCCTACAGTGGATTGATGCGCAGAAG
AGTCTCATTCTCTGGGACAAACCGGAGCTCAGCGTCTACCTGGAGCCAGTCCGCAAAGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62