GenePrediction:GLEAN_5660 Details

Name: GLEAN_5660
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1736281..1735198 (- strand)
Length: 1084
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1736281..1735686 (- strand)
Length: 596
Type: CDS
Source: GLEAN
Position: GCSC_173:1735636..1735198 (- strand)
Length: 439
>GLEAN_5660 class=GenePrediction position=GCSC_173:1736281..1735198 (- strand)
ATGGTAAGCGAGCGAGTGGGAGCAAATGCAAGGGCCGAAACCGTGTCTGATTGCGCCCCAGTTTTCCATCCATGGCTGCG
CGGCCGCGTCCAGGCCGCCCTGACTCGCGCCTGGACGACACGCGTACCGGTCCTGCAGTACGCATCCCCGGCCGAGGTGG
CGGCTGGTGTTTTGCGGCAGGAGGTGTTGGAGGCTGTTTCGGAGGATGCTGCCATCCCATCGCGACCCTGGATCATCATC
GACTTTTGTGCCGGCGGCGGCGGACCGACGCCGAGCATCGAGCGTATCCTCAACAGCAGCAGCAACAAGAGCAAAACCAC
ATCGCCGACGCAGTTTGTCCTCACCGACCTGCACCCCCACATCGACGACTGGGCTGCAGCCGCGGCCCAGAGCCCCAACG
TGCGGTATGCAGCCGAGCCAGTGGATGCCAGTGCGGCCGAGCCGGCGGCGATTCTGGCGGCTGCCGGTCTGGGCCCCGAG
ACGACGGCGGCTCATCCACGGGTCCTGCGGCTCTTCAACCTGGCCTTTCACCACTTTGATGACCCGCTGGCCCGAGCGAT
CCTGCGCAACACGGTCGAGACCAGCGACGGCTTTGGGTGAGCTGTCGTGCTGTTGTGTAGATGTGTTCCTCTGCTGACTT
GCCAGCATCCTCGAGCTCCAGGACCGCTCCGTCTCCGCCTTCTTCACCACGCTCGCCTTCGGGCTCGGCATCCTGCTGAC
GGCACCCTACTACGCCTGGCGCTGGCGCTCGCCCATGACGCTCGTCTTCACCTACCTGCTGCCCATCCTGCCGTTTGTGC
TCGTCTTCGACGGCTGGATGTCCATGCTGCGCACCCGCACGCCCGACGAGGTCGCCGCCCTGCTGCACTCCTGCGGCGCC
ACCCCGGCCGACGTCGCCCGCTGGGAACTGCACAGCGGCGAGATTCGCCATCTGTGGCCGTGCGGCTACCTCAAGTGGAT
CGTCTGCGTCAAGAGACAGGAGTGCGAGGCGGTGAAGGCCGTCGAGGCGGTGGGAGCCGTAGGAGCGGTCAAGACCACGG
ACCAGTCTGTCCGCCATCGAGCCACAATCGATGTAAAGGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62