GenePrediction:GLEAN_5663 Details

Name: GLEAN_5663
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1715866..1714330 (- strand)
Length: 1537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1715866..1715795 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:1715731..1715700 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_173:1715510..1715504 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_173:1715449..1715405 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_173:1715343..1715186 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_173:1715110..1715054 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:1714988..1714634 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_173:1714560..1714330 (- strand)
Length: 231
>GLEAN_5663 class=GenePrediction position=GCSC_173:1715866..1714330 (- strand)
ATGACGGAGCAATCAAGCGCGGTACCAGAGCCGCGTGCATTCCTGACAGAGAATCCTCTGCAGGCTGACGATGTAAGACC
CCTCTCTGTGGATTTGATTCGATCCTGTGCACATGCTGACTGGCGGTGAGTCCAGGAGGGTTTTGACGACGGTGCCTCCC
TAAATTCGTACGTTTTGGCCGGAGATGGCAGCGGTGCCGGGAAAGGCAGGCTACTGACAATTCTGCCACTTCTTGCTCGA
TTATAGTGCAAGCTATATAACCTCGCTGAGCTCTAGCATCTACAACTACAAGCAAGTCCGGCCATGCAACCAGTCCGTTC
AGAGCGACAGCAACTAACCTGAGTCGTCCAATACAGATACGAGGTTTGATCCCTGTGACCGAGGTCTCTTCGTCGAGTGT
TGCTGCTGACTGCCTAGAACGGCCGTCGCTATCATGCATTTCGCGAGGGCAGCTACTTTGTGGTATGTGTCTGGTGGCTG
TCAGAGGAGTAGAGACCGAAGACCAAGACTGACATCGGCGTAGCCCAACGACGAGGAAGAGCAGGGCCGTATGGATCTAG
TCCACCACATCTACCGGCTCATACTCGGAGGAAAGCTGTACTTGTCGCCTCTGAAGGACCAGGTCGGCCGCGTGCTCGAC
ATGGGCACTGGAACTGGCATCTGGGCCATGGACTTTGCCGAGTGCGTGCAATGCTTTTTCTAATCATTTATTTGCTGTCC
GAAGACTGACGCTAGCTTCTTTCATTCGCTCTGCAGTGAGCATCCAGAGGCCGAAGTGCTGGGCACGGATCTGAGTCCTA
TCCAGCCGAACTGGTAAGGAGTGGCCGATTGCATAAGTAATGCCCTAGCTGGCACACAAAGGCCTAACAGGGCGCTAGGG
TCCCGCCTAATTGCATCTTTGAGATCGAAGACTTTGAGTCCGACTGGCTCTATGGCCGTCCGTTTGACTTTGTCTTTGGT
CGCGAGCTGGAGGCCTGCATCGCCGACGACCGGGCCTTGTTCCGCCGCGTCTTTGAGAATCTCAAGCCTGGCGGCTACTT
TGAGATGCAGGGCGTCAACCCGGAGTTTCTGTCCGACGACGACACGGCGAAGAAGGCCCTCAACGCGAACAAATGGATGC
AGCTCATGGTCGACGGCGCCGCCAAGTTTGGCAAGCCCTTTGACACGCCCATCCACTGGAAGGAAAAGTTCATCGAGGCC
GGTTTTGTTGATGTGAAGCAGGAGGTTCGCAAGGTAAGTAAAGCCGCATGGATTTACAAAGCAAAAAGGGCAGGCTGACC
TTTCGTTAACCTGCCGCATTGTGTAGCTCCCTATAGGCGCCTGGCCGAAAGACCCCAAGCTCAAGGAAATCGGCAGGGCG
CAGTCATACCAGGAGCTGCAGGTCATCGACTCGTACACACCGGGCCTGCTGTCACGTGGTCTCGGCTGGTCCGCCATTGA
GATCAACGTCTTCATGCCAATGGTTCGCACAGATCTCAAAAATCCCGACATCCATCTCTACCTGCCCGTCTACTTTGTCT
GGGGACGGAAGCCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62