GenePrediction:GLEAN_5665 Details

Name: GLEAN_5665
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1708386..1707428 (- strand)
Length: 959
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1708386..1708201 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_173:1708143..1708062 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:1707999..1707909 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_173:1707691..1707612 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_173:1707558..1707428 (- strand)
Length: 131
>GLEAN_5665 class=GenePrediction position=GCSC_173:1708386..1707428 (- strand)
ATGCGCTTGTGTGTCCCAGCTGCATCCCTGGACATTGAGGGCTTCGCAGTTCATCGCCTGCAGTCAAAGATGCAATATGC
CGACTTTTCAAACGAGTCTACAATCGAAACTATCTACTGCAGCGAGCTGGAGGACCACATAGTCAAAATGACGGGGGCTA
AGAACGTCCGCGTGTTGGACTATCAGGTGGGCCAATCCATCTCATTCTCTCTCCTTATCTGACACGTCCTACTGCTGTTG
CAGCTCAGACGAAAATCTCCTAGCTTCCCCTACTTTCAGGGAAAGCTTCCCCCCCGACCGCAGCCCAGCCTTGTAGCACA
CGTCGGTATGATGTTTCTTCCTGTGGCAGCTACTTCACCTCGTCATTCGTAACACTGCAATCTCCAGATCTCACGCCTGA
GACGGCCGAAAATATTGTTCGAGAGTTGTACAAAGATACAGCCGAGCAGATCCTACGGTCAAGGTATCAAATTATCACGT
AAGTCTCTGCCTAGTCTGTCGCCCAGATATCACACACCCGACATTGTTAAATCTATAGAAAGTATTTGGAAGCCATTTCG
CTTCCCGGTCCACGACTGGCCTCTAGCACTTTGTGATGCCACCAGCATTGATAGAAACGACTTAATTCCTATGGATATAA
TGTACCCGAATTATTTGGCTGAGAACTTTATGGTCTGCCATAACCCAAACCAAAGATGGTACTGGTTGCCGGACCACCAG
ACCGACGAGATACTTGTCTTCAATGCATTTGACTCAGAAGCCCTAAGCTCTTCGCGTGAGTTTTCATATCCTCCAGAAAT
CGTGCCGATCTCGCACTAAGTCCTTTAGCTTGTGCCCATGGCGCATTTCCGCTTCCCGGGGAGCATGGAGACGCACCGGC
CCGGGAGAGCATCGACGCGCGGTTGCTCGTCATGTATGCGGATATCAAATATCCTGCACCTCAGCCGCAGTCAATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62