GenePrediction:GLEAN_5666 Details

Name: GLEAN_5666
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1706226..1697691 (- strand)
Length: 8536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1706226..1706187 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_173:1706107..1706068 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_173:1705586..1705244 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_173:1704983..1703491 (- strand)
Length: 1493
Type: CDS
Source: GLEAN
Position: GCSC_173:1703313..1702825 (- strand)
Length: 489
Type: CDS
Source: GLEAN
Position: GCSC_173:1702750..1702517 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_173:1702277..1702214 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_173:1701553..1701461 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_173:1701135..1700823 (- strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_173:1700662..1700616 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_173:1700364..1699679 (- strand)
Length: 686
Type: CDS
Source: GLEAN
Position: GCSC_173:1699588..1699273 (- strand)
Length: 316
Type: CDS
Source: GLEAN
Position: GCSC_173:1699216..1698050 (- strand)
Length: 1167
Type: CDS
Source: GLEAN
Position: GCSC_173:1697966..1697691 (- strand)
Length: 276
>GLEAN_5666 class=GenePrediction position=GCSC_173:1706226..1697691 (- strand)
ATGAACTATCGTAATAGTGGTAATCGGCAGGGAACCCCGGGTACGGAGACTGGGGGAGGTGGAAGTACGGAGACGATTAG
CTCCGCTGATCCGCACAAATCTAACCTGATGCTAAGCAGTGAACGTTCACGTCAATGAAAATTCAACTTTGGAGCTCAAG
TAAGTCGATTGAAATCTTCTCGTGGTTTATTCTCCGAAATATTCTGAAAATGAGAACGTTTCTGAAAACGATTTCTTGCA
GCATAGTTGCCATTCCAGGTTTTGGTACGCCGGACACGTCTACTTGGGGACTAAAGTCTGAGCTATGTGAAGCAGCCGCA
CAAATAACGTCTCTGTCTCGGATTCACATTTACACATATCCACTGTCGTATGTACCTGTAAAATATTTCTCCTGGAAAGA
ATTTCTCAAGACTGGGAGTGATCTTGCTGAAGAGCTCGCACGCCTCACAGACAAGGTGAGAAAACAGTGTGGCGGTTTGA
TTATACCAGTATGTTGGAAAGCTGACCGGGCCACATCCTAGTCTCCAAACCGGCCCATAATCTTTATCGCGCATTCCATT
GGTGGTGTCCTTGTCAAGAAGGTACGATAAAACACCCACCTGCAGGGCCCAACAAATATGCCATTATAACCTACTGACAG
GCAAACTTACAACCAGGCACTGCTTTTGGCCCGCCAAAATGTCCACGACCACAGGTTCAAGCTAGCCATCCGGCTCTTTT
CAGGCATTATATTCATGGGAACGCCGCATTCCAGTGGGTCCGATAAGGACACACTCGTGCGGTACAATCAGGTCCTACAT
AGCTGCACCAAGACTGTAGCCCCAAAGCAGACCAAGAGGCCATCCGAATATGTGCGGCCGCTAGCAATTCTTGCCATGGA
GTTTAAGAACATTGCCGATATTCCCATCCTTTCAGTGTACGAGGATACGGCAGACCAAGATCAGCAAGCCAGAAGGCCGA
AATACTTTGGAAGGAAAGCCAAGGTAATTACCACCCGCCCGCATGATTCTAGACAGACCTCCCCAGCTAACACAATTCTT
ATCAGCCCCAGTCGCTAGTAGACCAGCAGCTTGCCAGGATAGAATCTAGTACGGAGCAGCTGCTGGGGGCAACTCTCCCT
CATGCACAGCTGTGCAATCTACCTAAGCTCACGAATGATAAAGGCTCAGTACGAGACTTTATTCAATTATTGCTTAAAGA
ATTGGAAGGTATTACTGAAGCATGACAAGAACTATAAAAGCAGACAAAAAACCGCTCTTCTGACCCTCCAGAAAAACTGG
GACACAAAAACAAAGAAACGACAGTTGAAGCCAGGCCTACTCATCGAAGCTCTACCAGTCATCCTCGCATCACGTCCACT
TTGAGCACCTCGGGGACCAGAGTGGCACCATACTCTGGGCTTCCGTTGCATCAGCGTCTCACGTCCAACAATGGCCGCAC
GAGTCTGCTGGACACTCGGACAGCTAACTTGCCCTGCTTCAAAGTGTCCCAGTTGCCCAACCCCTACTTCGTCGGACAGA
ACGACATCTTGGAGCTGATGGACAAGCACCTTCTTCCGCCGGTGCAGCCAAGAGGGGGCTTTCAAGACGGTGACGACCGG
GGGCACATGCGCCGATTCGCACTTTGTGGTATGGGCGGAATCGGTGAGACTGATCTCGCCATCAAATATGCCTACACTAG
GCGGGAAAAGTTTGATGCCATATTCTGGCTTCAAGCCGGGGGGGACTTACAACTGGCGTCTGATTTTGGCAGTGTATCAA
CGCAACTCGGACTACAGATGCCAGAGGAGGCAGAAAACCTTCAGGCAAACATAGAGGTTGCAAGGGTGTGGCTAAATAGG
CCGTGGAACCTCGACAGGCGAGAGAACGACAGCTGGCTGTTAATTTTTGACAATGTCGAAGAGCTTGAGACGATAGGGCC
CTACCTTCCTTCCAATGGTAACGGAGCGGTTCTGGTGACGAGCCGTAACCCTGCTGCGAAGGACTTTCAGCCCCTGGACG
GACTAGGCGTTGACCTGGAGCCCCTACCTGAGACAGATGCAGCAACCTTGCTATGCAGGCTAACACAGACACCAGACAGC
TCGTCACAGAGTACATTGCCGCCGGACGAGCGTGCCGCGTCTGAGGAACTAGCAGCGTACCTGGGAAGCCTACCGCTGGC
CATGACACAAATGGCCGGGTTCATCCGCCGTAGGCGCTTGTCGATCCGTGAGTTCATGGACCTATACGCCAAAGACACTC
GCTACACTGAGATACACGACGCTGGCAGCCCACTACAGAAGCAATGCTATGGTAACACCCTGGCGACAGCCTACAACTTT
AAGGACCTAAGCCGCCAAACTCTCGCCCTCCTCCGCGTCATGGCCTTTATGAATCCGGATAACATCCGGGAAGACATCTT
TGCCGGGCCATCAGGGCCACAGCAGATGCAGGCCAATTCCAGAGAGAGTCTACGGTGGACCATCTCGGACTTTGAGAAAG
CCCGCCACGAGGCCTCTACGTCGTCCATCATCAAGCGTGACATGACAAAGAGGACGTTGCAGATTCACCGCATCATTCAA
GCCGAGATTCGCGCCACTATGAAGGACGAGGAGCAACGCTATTGGGCTTTCCGAGATGCTGTGACACTGCTGGCAGAGTT
CTGGCCACCCGGCGACCATAGCAGCCAAAAGATTGTCCGCTGGGACCTTTGCGGAAGTCTGAATGGCCGCATCTGGAACG
CTTTTATTATTTTTACGTCGAGTACGAAGAGACCTGGAAAACATTCAGGGTAGACTCAGCCTTTCCCAAACTCCTAAATG
AGGCAGCCACGTAAGCGAATAGATACAGACAGCAACGAACGAGGCCAACAAGCCAAAACGTGACGGCGTCTGCAGCTCGT
CATACTATGCCATTCTGTTAACTGTCTCAACAGATACTTGCACGAGCGAGGATTCTCGCACGAGGGCAAGCAGTATCTGG
AGCTAGGCCTGTCCCTATGCAGTCGAGATGGCATTGTGCTTGAGCCACTCATCAGCGACATGCACCTTTGCATGGGTGCC
TTGTGCAACGAGACGAACGACACCGAGGCCTGTCTCGAGCATAACATCAAGTGCCTCAATATTCGCAAGGAGGAAGCCGC
CCGAGGTAAGCCACCAGACCTACGGCTCGCATTTGCCCATAGCCAGATGGGTATCGCCTACATGATGGTCCGCAAGTTCG
CACTCGCCACAGCCTACTTTCAACAGAGCGTTGATATGCTGAAGTCCATTAACGTGGATCCCGACGAGTTCGGCTTTCCT
GCATGTAATCTTGGACTGGCATATTGGGTCCAGGGCGAGATTGACACTACAGATGATATCCTTACAAGGCTCCTGGCTCA
ACGAGAACAGCTACACGGAAAGCTGGACCGGGTAATTTACAAGTGAGTAAGAAGCGCAAACTCTAACGGATTCGTAGCTG
GCATTTGCTGACCATTCCATCAATCCTATGGTAAAGGACTGGACGGGTTCTTCAAGCCCTTGGGAACGTGCGCGCGAGCA
AGGCAATGCGACTTGAGGGCGAGGGCAAGCATGAGGATGCAAGAAAATTTTGGGAAGAATCATTCTTAATCCACCAGAAC
TGTCTCACGCAGTACGAATCCACTCTAGGTGAATTTAGTCACCGCACGGCTGACGCTTTGCACAAGCTTGCGGAGCACCA
CATCCGACGAAAGGAACACGTAAAGGCTCAGTAAGCCCCCCCCCTCCTCCTCCCCCGCCTGAACAGGAATTCTTAGACAA
TAAGTATACTTACCTATATCTGTCCAGGAGTTCACTTGAGAGAGCTTTAAACATCTGGGGGGACCGGCAGTGGTACAGGA
ACGAATATGCTCGTTCCTCCTATCTAAGAGGCATCCATCTTTTGTCGATGGGCGGCGAAGCAAATATCTAAGAAGGAGAG
CAGTGGGTAGGTCGGGCTAAGCTGATTAGGCGTGCGATTTTGCCCAACGAGGAGGAGCTGCAAGATCTTGACACTGTTGA
CTTTGACGATTTGGTTTGTTTCTGGTCTATATAAGAACTTTAGTATACTTATATAACCTTTAAAATTAGACGTTATTATA
ATTAGAAAGTGTTCAGCGTTTTCTATATAATTTACAAAACATTTATAAAAGCTAGTTATAAATTTTATAACCTTATACAT
AGTGACGCTAACCTAGGTGCATAGTGCATCTAGATGCGTAGAGCGCGGTGCAAAGTCATCGTAGCGGTGCCTATAGCAAC
GCATGTCCTAGGTAGCGCTAGATGTACAGGTTACAGGGTACGACAGTCGCTTATAGGGACTTCGATCAGGTTCCTTAGCA
AAGAGTAGTTGGAAGAGGAAGGATTACGAAGTCTTGGTAGGTGCTTGATTGCCTCTACCTAAAGGATGCGCTGTGTTGGA
TTAGAGTTCTCTTATATAGAGTAATGCGCGATACGCCAAGCAGACTGCGGCGCGAGACGTAAAGGATGAAAACATAGAGA
TAGAAGCGGAGTGCGTAGGTACGATGATACTGTGTTCATAGTAAGTGTAAAGCTAAGGAATAAAGGCACTGTGGTTGGCG
AACTTTCCACAGCGACAAGTACAGCGACTCGCAATACTTTATGCCTAATGATGACCGGCAGCAGGAGTGTATTTACATCA
GGTGCGACTAACCGCATATTAGTCTTCCAGTAGCTTGCCGACGCCTTTGTGCATACTGGCAACCACTACCTGACGTTGCT
GCTGGACGGCGCATTATTTCTAGCTCCCATCTCGGATACTGTTTATGTTAGTAGGGAGCGTGTGCTGCCAGTAAGAAGAA
CTAAGATACATGTTAGACGCACTGAATCGATTAGAAGGTGGTCGATATTGGCACTGGCACTGGCACCTGGCAATGTAAGG
AATCCCCGCCATTACTACATTAAACCATGACTCTGATTGGGGCAGAGACTTTGCCGATCAGTTTCCGAATGCAGAGGTAA
TCGGCACGGACATCTCGCCCATTCAGCTGAAATGGGTGCCGGCCAACGCCAAATTTGAGGTTGACGAGGCGACAAAGCCG
TGGACGTGGACAACAACACGTTTGACTTTGTCCATATGCGCTACATGACAGGCGCCATTATCGACTGGAAAGGGGTGTGC
GGAGGCGTACCGCTGCTGCAAGTTGGGCGGCTGGTATGAGTCTGTTGAAGTAGATGTCGAATTCCAGAGCGATGACGATA
CAGCCAAGCTGGCCCCAGTGCTGCAGACCTTTTGGCAGCTGGTTGTCCAAGGCATCGGAAGGCTAGGCCGGTCGGGCCGT
GTAGTTAACGACGGCCTACAGGTTAAGTCGATGGAAACGGCCGGCTTTGTCAATATCCAAGACAGGAGCTTTATGCGGAC
CATCGGCGGGTGGCCAGCCGACCCGAAGCTGTCCGAGTGGGCCGGTATGTCCTACTAGGGGTTGATAAACGACCTTGAGG
GTGTGTCTTGATTCCTTTCTTCGAGTGCCCTGAGACGATGCTAAATACCGGTAGGATATACGTTCTTTTGTGGAGCGAAA
CCATGAAATGGGGCACGTTGAGTACCAGATGTTCCTGATGGAAGTGCGCAAAGCCCTGAAGGACAAGGGTGCACACGTAC
TACACGGTACGGTTTGTGTGGGGGCAGAAGTCGGTGGATGGGTAGGCAGCGAATACTTGGAAGAGCAGTTCACTAAGTGG
ACCACTACTGCAGCTCCGGGCAATGTGACCAAGTTTAAGCGGAGTTTAGCCGGGCGGTCGGGTAAACTTCGGGACAGACG
GCGTACTTAAGCGTTGTTGAAGCACCCGGATCTGCCACAACTCCGGGAGCGAGCACGTATTATACACAGTCTGTAGACAA
ACGGCAGTCCATCCACTAACAGAGCGAGAAGATGGCCGACATTGACGTGGAGCACGTACTGGGGCGGCTGAGCGATGAGG
AAAAGGTGTCGCTGCTGGCGGGGATTGATTTCTGGCATACCAAGGCGCTGCCAGCGCACGGAGTGCCATCGCTGCGGCTG
TCGGACGGACCAAACGGTGTGCGCGGCACGCGGTTCTTCAACGGGGTGCCAGCGGCGTGTCTGCCGTGCGGGACGGCGCT
GGGGGCGACGTTCGACACGGAGCTGCTGACGGCAGCCGGCACTCTGATGGCGGCCGAGGCCAAGGCCAAAGGTGCACACG
TGCTGCTGGGCCCGACAATCAACATGCAGCGAAGCCCGCTAGGCGGCCGAGGGTTTGAGTCGTACAGCGAGGACCCGGTG
TTGGCCGGACTGGCAGCGGCGGCGGTGGTGCGCGGGATTCAGGCGAGCGGCGTGGTGGCGACGATCAAGCACTTTGTGTG
CAACGACCAGGAGCACGAGCGCAACCGGGTCGACGCGCTGGTGACGGAGCGGGCGCTGCGCGAGCTGTATCTGCTGCCGT
TCCAGCTGGCGATCCGGGACGGCCGGCCCAAGGCGCTGATGACGGCCTACAACAAGGTCAATGGCGAGCACGTGTCGGAG
AGCCGGCGGCTGCTGGCGGACGTGTTGCGCGGCGAGTGGGGATGGAAAGGGCTGGTGATGAGCGATTGGTGAGTGCTGGT
GAGGTCAAAAAAAAAGTTTGCAATGCGCGATTCGACTGATGCGATGCGAGCATTCGTCCGTTAGCTAACCCAACCCAGGT
TCGGCACGTACTCCACCACCGAGGCCATCAATGCCGGCCTGGACCTCGAGATGCCTGGTCCGTCTCGCTGGCGCGGCGAT
GCTGCTCTTCTGGCGTCGTCGACGTTCAAGCTGCAGCCCGACGCTCTAGATGAGCGGGCCCGCGCCATGTTGGAGCTGGT
GCGCGACTGCCACGCTTCGGGCGTGCCCGAGAATGCGCCGGAGGGCACTAACGACACGCCCGAGACGACGGCGCTGCTGC
GACGACTCGCGGCCGAGTCGGTGGTGTTGCTGAAGAACAAAGAGGCCGTGTTGCCGCTGAGCAAAGAGAAGAAGGTGAGT
GTGTGGCTGTGCTGTGGCTTGTACTCCGCGCTAACCGGTCCCGACAACAGACGCTCGTGATTGGCCCCAACGCCAAGACG
GCGACGTTTTGCGGCGGCGGCTCGGCCTCGCTGCTGCCCTACCGCGCCGTGTCGCCGCTGGAGGGCATCACGGCCAAGGT
CGGCGCGGCCAATGTGGCCTACACGGTGGGCGCGTACGCGCACAAGGATCTGCCGGACCTGGGGCCGCAGCTGACGACGA
CAGCGGACGGATCGAAGCCAGGCTTCACGTTTGTCGTGAGCAACGATCCGTTTGTGGATGACGACCGGACGGAGCGAACG
GTGATCGACTCGCTCGCGTTTGCATCGGCCAACATGATGTTTATGGACTACAACAACGCGCGGCTGGCGGCGACGTGGTA
CGCCGCCATCGACGGCTACCTGACGGCCGATCGGACCGGCGACTTCGTGCTGGGCCTCTGCGTCTACGGGACCGCACAGC
TCTTCCTGGACGGCCGCCTGCTGATCGACGTGACCGAGCACCAGACACCCGGCTCGTCTTTTTTTGGCTGCGGCACGGCC
GAGGAGACCGCCACGGCGCCGCTGGTTGCCGGTCAGACGTATCACGTGCACGTGCGCTTTGGCAGCGCCAGCACCAGCCG
ACTGCGCCGGTCCGGCGTCTCGTTTGGCGGCGGCGCCATCAAGCTGGGCGGTGCCTGGCTCATGGATGCCACAGCCGAGA
TCGTCCGGGCAGCCGGCCTGGCGGCCGAGTACGACCAGGTCGTCGTCTGCGTCGGCCTGAACCAGGATTGGGAAAGCGAG
GGCTTCGATCGACCGGATATGCGTCTTCCAGGTCACGTGGACGCCCTCGTGACCGCCGTCACCGCCGCCAACCCGCGCGC
CGTCGTTGTTGTGCAGTCGGGCACGCCGGTCGAGATGCCCTGGCGCGACCAGGCTGCCGGCCTGCTGCAGGCCTGGTACG
GCGGCAACGAGACCGGCCACGGGCTCGCCGACGTGCTCTTCGGCGACGTCAATCCGGCCGCCAAGCTGCCGCTCTCCTTT
CCCGACCGCGTCCAGCACAACCCAGCTTACCTGCACTATCGCTCTGAAGCCGGCCGCGTACTCTACGGCGAAGACATCTA
CATGGGCTACCGCTACTACGACTCCCTCGGCCTGCCCCTCGCCTTTCCCTTTGGCTTTGGCCTCAGCTACACCACCTTTG
CCCTCGGCCCGCTGTCCGTCCAGCTGCAGAACGACTCCCTCCATGCTGCCCTCACTCTCACCAACACTGGCGCCCGTGAA
ATGGCGCCGAGGTCCTCCAGCTCTACGTCCGCCAGCACGACCCCGCCATCCGTCGTCCCACCAAGGAGCTCAAGGCCTTC
CGTAAGGTCGCCGTCGCTGCCGGCCAGCTTGTCGATGTCGCCCTCGACGTGTCGCTCAAGTACGCCTGCAGCTACTTTGA
CGAGCGTCGCGCCCAGTGGATCTGTGAGGCTGGCCGGTACACTGTCTACGTGTCGACCAGCAGTCGTCTGGACGAGGGCC
TCTTTGTCGAGACGTCTTTTGAGGTGCCAACCACGTTCTGGTGGAGTGGTTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62