GenePrediction:GLEAN_5668 Details

Name: GLEAN_5668
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1694174..1691447 (- strand)
Length: 2728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1694174..1694133 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:1694067..1693642 (- strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_173:1693566..1693492 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_173:1692302..1691860 (- strand)
Length: 443
Type: CDS
Source: GLEAN
Position: GCSC_173:1691681..1691447 (- strand)
Length: 235
>GLEAN_5668 class=GenePrediction position=GCSC_173:1694174..1691447 (- strand)
ATGGTCGCTATAGTGGTGGCCACGACAGCTAGAGTCATGGTCGTGGCCCCAGTCGTGGAAGACCTTTGGACGGCTACAAT
GCTGACCAGCCATCAAGATACCTTCAGCATGGACATGTCCCTCTCGACAACCGCCAAAGATACCAAGCAGGCTTGCCGCT
CATCGCGACAAACCGCTACCGTAGCAACCAGTGCCTAGGAAATTACCGAATTCGACCCAGGGGGCTGGACGAACCTGAGA
GGTGGGCTGAGACAGAGAGATTGTCGAAAACCTATGTCCAGCTACCGCCCGAGCCAGCTGGGCAGACCGAGAAACCTGAG
CAGCTCGAGCAGCCCACGCAGACTAGCCAGTTGGGGGAAGTCGAGGAATCCCAGTCTGCCAGTGACGCTGCCCCGGTTAC
AGCTTCCATTACGGAGGACCCATTCAAGAAGTATCTTGACAAGATCTTGAAGCGAGTGCACGGGAAGAGGCGCCGTGAAC
TCAGCCCCACCAGTGGAGGAGCAGGGTCGCGGCGGCCGGACGTGTTCTCAGCAGTATGAACCCCTGTTAATCACACCCGC
GGAGAAGATATGGACACTTTGAAAGTGCTTGCTAAATTGTAGAAACAGACCATCTGCCAAGAGGACAGCTATATGCACAG
CGACACCGATTCTGACTTGGACCACCGGTCGGTCGTCTCGACGGTATGTCTCTTGTTTCGGTCTCCCAAAGTAGAAAGAG
AAGTTGACTGATACTGACATGTGTTTAGCCAGCCTCATGGAGCCATGCCGTCATATGATCAAACCGCCCAAGAGAAGGGA
GTCGCTCCATCCGACTAACGACGCCTGCAGAGACGTTTGGAAGGCCGTAGTGGCGAACCTTTTTGGGAAACTTTGAAGAA
ACTCAGACCAAGATATTTGTCCTTCCTACTTCGCAAAGGAAGAAAGAGCGTCGGCGCGAATGGGCATATGAGGGGCTAGA
GAGGTTAGTGGGCATAATTATGCGGAAGGGCCGGGCATTGTTCTTCTAGTCATATTCTGTGTTCTTTCTATTCTTGATGT
AAATGAGGGATGCCGTCGTTGGTGAGATGCAATACCAGGCCAAAAGAATCAGATTGCACCAGGCTAGATGCAAGTACAGA
GTAAGATACAGCCAATGGCTGTTGTGATCAGATACAGGTAGCACTACGCACTGCTGAAAGCCGTTGTGTTTTGCGCACTG
GCCACGTTTCCAGCCACGGGGCCAGCACAAACTAGCCCAAAAATAGCCCATCGGAAGAGGAGTGAGAGCAAGGCGATGTG
CATGTATGCGTGCCCGGTCCCTTTGTCAGACAGCCTCGACAGCTTAGTGTTTCTAGAAGGGGTACGATTTTTTACGAAGT
GCTGTGTATCTTACGAGCAACGGCCGGTCTCCCGTATTCGTCAGCCGGATCAGTGCGACCGTTTAGAATATACATAGCAA
GATACATTGCGTCTTAAAACCACGCCCCTCTTCCCCTCCTTCTGTTTGCGGACTCAACCTGCACTGATGGCATGTAGCTC
TGATTGGACCGTCGAGGTGTGACGGCGTGGCTGCACGTCTTAAGCGCCGGGCAGGTTCTTCGCTCTTCGTTCTCGTCCGG
ATGCGCTGGGTCATACATAGTAGCTGTGCCCGATGTGACAGTGACGAGGACGGCGGGTGTGTGAGGCAGAGGATCAGATG
GCCAGGCTGAGTCACCTGAAAGAGGCTAATCATCGCACGAGCAGTCGACCATGTAGCAGCCCGACGGATGAAAGCAAATT
TGCTTGCAAAGGCCAAAGGCTTGAAGCAGAACGAGGACGGGACATTGCTGGCGATGCTTGGGGAGGGGGAGGGGGAGGGG
GGAACCGTTTGTTTTCCTGCATTAGCCGTCAGATTTCTCCACCGTCAGACTGGGAAGATGACGGGCTGATCCAAGCGATT
CTGCCTCCCATCCGGCCCGCGGCTCTCAGCTCAGAGGGGAACTGGAACCGATCAGATAGGGCCTCTCCGACCGGCACAGC
AATCAGGCCGTTCGATTCGGCGGAAAGACAGCCGAGCGATGCAGGGCGACGAGCCAACGACGGCGGTGCGGCCGAAAGGA
GGGATCATGAACATGTCGTGCTCTTTGTTCCCGGCGGAAAGAGACAGCGCTCGAGCACAAGACGAGTCCATGAACAGGCT
GCAGCAGAGGACCCGGCTCGCTCAGAGACCGAGGGCCAGACCGAGAACAACTGGACAATGGCAAGAGGCCGCGAATGGTG
GCCGCACAGACTGCCGACACTGCACCGGATTGCCTGCTTCGGGGGCGGGGAGGGGTGCTGCAGGTGGCCAGCCCTGTAAG
CGAGAGCCCTATTGCGAAGATATGGGTACTGACGTCGCTGCGACCCCTCTCAACCGCTGCTCCACCCGCTGCACTAACAC
CTCTACTACCACTAACACCACTAACACCACTACAGCCATCACCACACCACCCGCTGTCCACTAACCACACCACACTGTTC
CGCACACCCTCAGCTTGCCGGGCGGCTCGGCTGTCACAGCGGTCGGCCAGTGGTATCTTTATGTACGCGCGCAGGCAGCG
ATGATGCTTTGCGTTCTATACCGAGTCCGAGTTGTGCACATTCCCCAATGCCTCGCCAGAGACACGGAGCCGCATCGCAG
CGCATGCGATCTCGACATGGGAGCGGATGGCAAGAGCCGACAGAGGCCTACCCTAGAGAGGCACCCCAGAGCGGCCATTT
CGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62