GenePrediction:GLEAN_566 Details

Name: GLEAN_566
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:641400..641999 (+ strand)
Length: 600
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:641400..641634 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_97:641692..641999 (+ strand)
Length: 308
>GLEAN_566 class=GenePrediction position=GCSC_97:641400..641999 (+ strand)
ATGGCCGCCTCCGACGACGCCTACGCGGCCTTCCTGAACAAGGCCAACCAGGACCCCAGCGGCGGCTACGCCTCGACGCC
TTCGCCGGCCCAATCGGCTGCCGTCGATGCGGCTACCAAAAACGCTCCCGCCGCGCTCGTCGCCGCCGTCCAGGACGTCT
TTTACATGAGCGACAGCGACGAGCCCTTCTCGGCAGTCGCCTTGCCGTACTCGAGCAGCACGCTCCCCGATGAAGGTGAG
CCCTTTTTATTGTCTCGTCCCCTCTTCTTCTCCTTTCCTGCTAATGGCACAGACACCTTTGTCAGCCTCGCTCTGGGCTC
AAGTCCCGGCGCTGAGGTGACCATCATGGACCCCTTTGAGTGGGACCCAAAGGGCCGCTACAAGCAGCTGCTGGACGCCG
TGCGCGAAGCCGGACACGGCAACGATGTGCGCGTGTATCGAGTCCAGTTTAAGAACGCCTCGCAGGTGGAGTACTGGCTG
GTGACGGTCGACGAGGCCGACGACGAGACCGACGAGGGCAAGGACGCAAGAGGAGCAAAAAAGGCTGTGCCCAAGAGCTC
ACAGCTGGTAGGCGTCAAAGCCCTGTCGATAGAGAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62