GenePrediction:GLEAN_5670 Details

Name: GLEAN_5670
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1677091..1674403 (- strand)
Length: 2689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1677091..1675605 (- strand)
Length: 1487
Type: CDS
Source: GLEAN
Position: GCSC_173:1675381..1675101 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_173:1674929..1674725 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_173:1674451..1674403 (- strand)
Length: 49
>GLEAN_5670 class=GenePrediction position=GCSC_173:1677091..1674403 (- strand)
ATGGACGAGAGAGCTCGAATTCCAGTGACGCTGCCGCGTGACGGTCCAACGAAGCCATTCTGGCAGGACCCGCCGGACGC
AGCCATTGCGGACCTGCAGTCGACGCCAGAGCTGCCGAAGTCGGTTGACATTGTGATCGTGGGTAGTGGCATCACAGGGA
CATCGATTGCATGGCACCTGATGGGAGAGAAAGAAGTTGGGACCGGGAAAGGATTCCCCTCGATCCTTATGTTAGAGGCA
CGACAGGCTTGCTCTGGGGCGACGGGCCGCAACGGCGGGCACACCAAGGCAGCATCGTACCGGTCATTTCTGGACCACGC
AGAAAAGCACGGAATGGGGACAGCGGTGCAGATTGCGCAGCTGGAGCTGGACGGGATCAGGGCGGTGCATGCGATGGCAA
CGGGTGAGGGTGGTATGGCGCCCATTGCGTGCGACGCGTTGGCCTGCGAGACGGTCGACATCATCTATGACCCGGCACAG
TGGACGACGGCACAGAAGGCGGTAGCAGCGATGCGGGCAGCGCTGCCAGAGGGCGACGCGGTGGCGGACTACACACTGTA
CAACCGCGAGGAGGCGCTGGCGGCATTTCCGTGCAGCGACGACGGCGTGGCAACGCCCATCTGCGGTGCTGTTCGCTATG
CAGCCGGCAGTGTGTCGGCATACCGGCTGGTGGTGGGCGTGCTGAAGCGCTGTCTGGCCGGCGGGCTGAACCTGCAGACG
CACACGCCGGCTCTGAAGCTGGAGCGGACAGAGACTGACCTCTGGAGCGTGCAGACGGCTCGGGGCACTGTCACGGCTCG
CCATGTCGTGGTGGCCACCAACGGCTACTCGGCCTTTCTGATGCCGCGGCTGCAGGGCGTGGTGGTACCGCTGCGTGGAC
AGATCACGATGCATCGGCCAGGGGCTGCGATGCCGGGTGGCGGCAGCCTCGAGACAACGTACAGCTTCATCTACGCGGAC
GGCTACGAGTACATGATTACGCGACCGCCGGGATCGGTCCATGCGGGCGACATGGTCATCGGCGGCGGTCTCAAGTTTGC
GGGAGGCCACAAGGACAAGAGCAGGCTCGGTCTCTGCGAATACGGCACGACCGACGACACGACGCTGAATCCGGCCGTGT
CGGCGTACCTGCGCGAGACGCCCGTGCGGTATTTTGGCGGGCGTGACGGCTACTGGGGCGACGACCACGTGGACGGCCGC
CTGCGCGCCGAATGGACCGGCATCATGGGCTACACGCCGGACGGGCTTCCGCTGGTGGGCGCCATGCCACCGTCGGAGCA
GGGTGCCAGCGACGGGCTCTGGCTGTGCTGTGCATTCCAGGGCCACGGCATGGTGTTCTCGTGGCTGTGTGGCCGGGCGG
CTGCGACCATGGTGCAGGGCCGCGACGATGCCGAGCTGCGTCGCTGGTTTCCCGACTGTTTTCGTGTGCGGGAGGAGCGA
CTGAAGCATGGCTTTGTCGGAAGGTTGCATGTGTCGGCGAAGACGGAGTAGGTGGCAGGACGAGAGGACGACGACGACGA
CGACGAAGACGAGGGAAGAGGACGGAGATGACTGAAGACAAACACACAAACACACGAGCACACGAACAAGAAGTAAAGAT
TAGACAAGACAAGAACAACAACGAGAACGACAACAAGACGTGAACAATTACTGAATAAAAATGCACACCGATCCGGAGAC
TTTCGACTCTGAAAGAGAATACTCTGACAGAGAATCGAAACAGCAAACCTTGGACAGCCGCACCAAATACCCACCAGCAT
GGGTAGACATAACAGGCGACCGCCGCCGGGGTGGACGATCTGCTGGGATTTTGCGGGACAGCGAGGCGGTGAGCTCTGCC
GCCCCAGGCGCCCGGTCCACCCCGTCAGGCAGCCTGCAGGGCGGCGGTTGGTCGTGCTACTCCCTCGGTGAGCGGATGGC
CAGGGCAGCAGGCCTCGATGTGAGATATCACCTCGTGTTCTCTGGTAGCGACGGCTGTGCACCTAACTATTGTAAATTAG
CCGGCTGGGGCGTTGCACTTCTCTGTACGATTGCATGGCTGCTTTGTGTGATTGTGCAGAGTATGATGGCACGATATGAC
TGCACGACTGCACGACTGCACGACTGCACCTGCATGTCTGCACGACTTCTCTCTCCACGACTCCGTCCACGACTCCCCAT
AGACAATAGGCCGACTGCACGACACGATGGCAAAGACAAGTTGCCGGAGCTTCGCATCCGCTCGGCGATGAACCAAAGCA
GCAGTGCTAATTTCACGACTTCTCCACAGTGGACCGACGCTATTTTCCAGGCTGCCAGCCCACCGGTAGCGCTCCAGACC
CCCGGAACAATTGCCCTAAAACGGCAACCGGCATTGGCGGCTAGCACGTTATGCGCTCGGCCGGCCCCCCTAAAAATAGG
TTGAAAGCAAACCTGGACGCGAAGGCTCCTTGGGAGAGGGGGGGGCTCACCCGCCTTTTCTATTGAATGCGAACAGACCC
AGCAGACTGGTTTGGAAAGCTGGATGACTTGCAGCCATTGGTGCACGACAGCCAGCAAGCTCGTTGCTTAATCTTGTCCG
GGGATTTTTTATATATATATTTTTGCGGTTGCCGCTGGCAAGGGCCAAAACATAACCCTTTCTCGATTTTGCAACGGAAG
TCGCGTGTTCCTCTTTGGGAAGGCCGCTGGCGCTCTGAACCGCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62