GenePrediction:GLEAN_5671 Details

Name: GLEAN_5671
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1671863..1670225 (- strand)
Length: 1639
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1671863..1671215 (- strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_173:1671154..1671125 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_173:1670982..1670225 (- strand)
Length: 758
>GLEAN_5671 class=GenePrediction position=GCSC_173:1671863..1670225 (- strand)
ATGAGTTCTCCGGGTAGAAACCATCAGCATGAGCGCGGACGATCGTCTGGGTCTGAGCAGCCGGGCTCACCGTCACAGCC
GTCGTCGGCAGCCCGACAGCCGCAACAACCACAGTCGATGGCCGAGTACTACGGCGACCTGGTGAACAACAAGTACTACT
ACAACTACTACCACGGTGCCAGCTTGGAGCAGCAAGAGGACGACCAGGACGAGGACGAGGACGAGCCAGAAGACGGCCAC
GAGCTGCTGGCGCGACTGGCACCACCGACAGTCGGTGGTGAAGAGGGCGAGGACTATGACGATGACAACAACCAGACGGA
CTCGGACTCGGACGAGCTGGACGAGGAGGGCGAATACCGGGCGTCGGTGACGAGCAGCGTGCGGGCACACGTATACGAGG
GCGGGATGCGCTTTCACGCGTACGAGGGCACGGGCAGCAACGCGCTGGCCGACGGGGAGACAGCCGGCGACGGGACGACG
ACGAGGCCAACAACACACAGAGGCCGGCTCTACGTGCTGCCCAACGACGAGACGGAACAGAACCGGGACGACATGAAGCA
CGCGGTGTCGCTGCTGGTGATGCGGGGACAACCGTTTTATGCGCCAGTGCACGAGCGGCTGGTGGAGGGCGGTGATGTGT
ATGATTTGGGTGAGTGGTGGTGGTGATGGTGATAGAAAGTGGTGATGACGAAAGATGCTAACAAGACAGGAACGGGAACG
GGAATCTGGGCGATAGAGCGTGAGTTTGGTTTTCCTCTGTTCCTCACACTCGTCCAATCTCTAGTCCTATATTTTCTTCC
TCTCTCCTCTTTCCTCTCTCCTCTCTCCTCTCCTCTCTCCTCCCCTCTCCTATCCTCTCTCTCCACCTGCTAACTCTCTA
GTCGCTGACAAATATCCCCGATCAATCGTGAACGGCGTCGACCTCTCGCCGATCCAGCCCAACTACGTGCCCAGCAACGT
GTTCTTTGCCGTCGATGACTTTGAAGATGACTGGGCCTCGCCGCCAGATGCCTTTGACTTTGTGCACATGCGCCACAGCC
TGTTCGCGGTCGAGGACCGGCCGGCGCTGCTGCGTCGCATCTTCCGGCATCTGCGCCCCGGTGGCTTCGTCGAGTTCCAG
GAGCTGCTCACGGCCGCCCAGAGCGACGATGGCTCCCTGACCGAGACCACGCCCTATGCTCTCCGCGACTTTTTCCGCTT
TGTCGCTGCTGGCATGCAGCGGTCGCCGCGGCTGGCCGGTGGCGATCTCATGGGGACGCCCTGGTCAGCTGCTGCCTCGG
CTGCCTTTTCCGACCGGCTCTGCGCCCAGCTGCGCGCTGCCGGCTTCGTCAATGTCCACGCTGCCGTCCACAAGTGTCCT
CTCGGCACGTGGCCGCGCGATCGTCGCCTCCGCGGCTGCGGCCTGCTCATGCGCACCGCCCTCATGGACGGCCTCCGCTC
CTGGGCTTGCCGCCCGCTCGGCTCCTCCGCTGGTGGCCTCGGCTGGACCAACACCCAGATCGAGGTCTTTCTCGTCGACG
TCCGCAAGGCCGTCATGGACCCCAACATCCACGCCTACTTTCCCCTGCACGTCGTCTATGCCCAGAAACCGGAGCTGGCC
GCAGACGGCATGGACAGTACCGCCACAGGACCGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62