GenePrediction:GLEAN_5673 Details

Name: GLEAN_5673
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1667073..1666018 (- strand)
Length: 1056
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1667073..1667045 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:1666954..1666018 (- strand)
Length: 937
>GLEAN_5673 class=GenePrediction position=GCSC_173:1667073..1666018 (- strand)
ATGTTTGACATCTTCCCCCGGGCTTTGGCGTAAGTGTTCTTTTTATTCGTTTCCTTCTTCCCATCCCCAAATCTTCACCT
CCTCGCCCTCAGACCTCACATCCTCACATCTTCTCGCAGCTCCGTAGCCTCGGTCCTCTTCCCCATCTTCGCCTCCTACA
AGGCCCTCCAGACCGCCGACCCCGCCCAGCTGACACCCTGGTTGATGTACTGGGTCGTGCTGGCCTGCATCACCCTGGTC
GAGTCCTGGACCGGCTGGCTGCTCGTCTGGATCCCCTTTTACCACTACTTTCGCCTCATCGGCATGCTCTATCTCGTCCT
GCCCCAGACTCAGGGTGCCCGCGTTCTGTATCAGACCCAGGTCCACCCCTGGCTGCAGCACCACGAGAGCCGCATCGACG
ACTTTATCGGCTCAGCCCACGACCGCCTCCGATCGGCCGGCATGGCCTATCTTCGCCAGGCCATCGCCTATGTCCGTGCT
GCTCTCGGTCTGCCCGAGGCCGTCGTCCCGTCTGCCGCCTCGTCGTCTCCGTCACCGCCCACGACCTCGCCCTCCTCCTA
CACACAGGCCCTGCTGTCCCGCTTCAGCCTGCCGAGTGCTCGCTGGCCCGGCGGCGCCACCGTTCCCGACGAGGCCACCG
CTGCTGCTGCTGCTGCTGCCAGTCCTGCCGGCCTCTACAGCCTCTTCTCTGGCGCCATCGACCGCGCCCTTCACGCTACA
GTCGAGCCCGGTGCTGGCATTCCTGCCACAGACGGCCAGCGCGACGTGCTGCGCGACCGCCTTCGCTCGCTCCTCACCGC
ACTCGAACGCACCGAAACAGACGACGCCAGCGAGCTGCGCAAGAGCCGCAGCGAGCCCGACTTTGAACGCATCGACGCCG
AGAGCGGGGCTGAGGACGAAGGCGGCCATGGTCGTGCCCCCGGCCTGCGCAAGCGGACAGTACCGGCTGCGGAACAGAAT
CCTACCAGTGGTGGCGGATCGTGGATGTCGTGGGGCTGGGGTGCTGGCGCCGGCGGTCCAGAGGAAACGGGCACCAGCTC
CGCCACATACAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62